Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2070
Contig Information
Length 662 bp
Tissue Dormant seed with water absorption
Clones 6 Clones [Download: CSV  ,  FASTA ]
whem4d15    whem15a08    whem15n05    rwhem4d15    rwhem15a08    rwhem15n05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 517
Evalue 7.59502e-51
Total Hit Count 451
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2070
GTCACTTCGATTGCATCAAATTCATGAAAGTGTGCAGCGATATGGTAGGCAATGGAGCCACTAAGGCCCTTTGCTAAGTAACAACTACAAAATTCCAATA
ACATAAGAAACCACGACACAAGCGCCTACTGCAGGACCCTCCCTCTGGCTTATATGATGCCGATCTTGTTGGCCACGTCAAGAGCATCGTAGTCTGGTGT
CAGCTTCACGTACGCCTTCTTCTTGCCATCAGGCCTGATGAGGGTGTTAACCTTCTTGGCCTGAATGTCATACATTTTCTTGACAGCAGCCTTTATTTTC
TTCTTGTCGGCCTTGAGGTCGACAATGAAGACAAGGGTGTTGTTGTCTTCAATCTTCTTCATCGCAGACTCAGTGGTAAGCGGGTACTTGAGGATCTGGT
ACTGGTCTAATTTGTTCCTTCCAGGGGTGCTGATCCTGGGGTACTTGGGGTCCCTGGCCTTGGACAGGGTCTTGGGGCGGTGAAATGTCACAGAAGTGCG
GATCTTCTTTGCCGTCTTCTTGATTGACCCAGACTTCACAGCCTTGGCAACCTTGGCGGCCTGGGCCTTGGCATCGCCCTTCTTGGCAACAGCAACTTTG
GGAGCCATTTGAGCTTCTCAGAAAAGCCTCTTGAACTTACCTTCCTGGGGTGCGGGCGCGAG
page-top