Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig1958
Contig Information
Length 1284 bp
Tissue Dormant seed with water absorption
Clones 5 Clones [Download: CSV  ,  FASTA ]
whem14k11    whem19d18    rwhem8j04    rwhem14k11    rwhem19d18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17011 [Oryza sativa Indica Group]
Score 870
Evalue 2.74137e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig1958
AGAGTGAGAGACGTGTCACAAAAATACAAATAGGTTGGCATAACGCATAACAGGCAGCTGTAGGGACATACTTTCAAGTTTCAAAGATCCTAAAATCAGA
ACCAAAATTACTAACAGATATCCATCGCTCGATAGCCAAAATACAGAGATTGTTAAGTCTTCACTCCACTACAGAACCCCTGGATTCCTCAAGACAACAG
TAGGGCAATCATGCTTCGGTCTGCTCCCTCAAGCGACGGATCGTGCTCCTGACGGTGACTGCACTAGCAGTGTTCATGGTATAGGCGCCGCCAGCCTTGA
CCTTGCCACAGTCCTTGCATCCCCAAATTCCAACAGCTTTCCTCTTCACAGCAAACTTCCCACAGAATTCACAGAAGTACTTGGAGTGCTGAGACACCTC
CATCTTCTTGATCTGCTTACGCAAACTGGCACCATACCTGGTACCATACTTCCCGACGATTCCGGCCTTCTTGGTGCGCTTCGTCATCTCGGCGGCGGGT
AGCAGGAGGCGGCTGCGGCGGCGTAGGCGGGGAGATGGCGGTGCGCGTGCCAATTACCAGCCTCCAGTTACTTTTGTAGTCGTCCAGAAGCGTCATCACA
CCAGGCTCTTTGCTAATAACCACAACGATCAGCGTACTGTTGATAGAAGCGGAAACATACTGCCTGGCACAGTTGTTGATTCAAAGATTTGCCATCCGAC
CGAGTTCGATTTCTACTTGTGTAGCCACGCTGGCATTCAGGGAACTAGCCGTCCTGCTCATTATCACGTTCTATGGGACGAGAACAAATTCACTGCTGAT
GAGTTGCAAACTCTAACAAACAACTTGTGCTACACGTATGCTAGGTGCACCCGCTCTGTATCAATTGTGCCTCCAGCATATTATGCACATTTGGCAGCCT
TCCGGGCTAGATTTTACATGGAGCCGGATACCTCTGACAGTGGGTCCATGGCAAGCGGTGCCCGTGGCCCTCCACAGGGCGGACGCAATACCAGGCCGTT
TGGGAATGTTGCTGTCAGGCCCCTCCCCGCCCTGAAGGAAAACGTGAAGCGGGTCATGTTTTACTGTTAAGGTCGTGATGGTCATTGTTTACACTATTAT
GCAAACCTGAAGATATTCGACTGAGTTTGGGTGTGTTAGAAGTAGTATTTGCACTGCATTGGTGGCACTGGGAGAACACCTCCATGCAAACTTTCGTTGT
TGCGCAGTCTGAAACTCTGTAACCGTCTACCTATCTGTGGTCGTATTTGAACTACCCTGAAATCATTTCTAGTTTGGGAAGGAC
page-top