Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1008
Contig Information
Length 749 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 5 Clones [Download: CSV  ,  FASTA ]
rwhfl10a18    rwhfl40p13    rwhfl40p14    whfl10a18    whfl40p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0273800 [Oryza sativa (japonica cultivar-group)] >gi|55296017|dbj|BAD69161.1| putative signal peptidase 18K chain [Oryza sativa Japonica Group] >gi|113595411|dbj|BAF19285.1| Os06g0273800 [Oryza sativa (japonica cultivar-group)] >gi|215734928|dbj|BAG95650.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215741150|dbj|BAG97645.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765142|dbj|BAG86839.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767019|dbj|BAG99247.1| unnamed protein product [Oryza sativa Japonica Group]
Score 554
Evalue 1.1641e-86
Total Hit Count 285
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1008
gagtgtTGCATAACACCTtggtgCGGCGGGCCAGATACATATTCAGAAGTCAAAACAGATACATGGAAACTTCCATTCAATACACGATGCAACATGTTCA
*GCTGCCGGTTACTTCTGCGCTACTACAAGACCAAACTACGACCCTGTGACAAGGTGGAATTTTCAGTCTTTCGACGTTATCACCAGCAGGCCCAGCGCG
CCGATCAGAAGGTACTTGATGATCGGCTTCTCAGTCATCACAATGGTAACCCACCCAACG*TATGGAAGATAGCCTACAGCCCGCCCCATGA*TGTGATG
CTGCTGAAGCCACAGCTGACCTTGTGCGTACAGCAGTCGGTCATCCCCAAAATTGTTGTCACCTTTCGTGAGGATGTCAACTTCAGCACTTTCCTGGCGT
TCATGAACCTTAATCACACGGTGAACAATTGGAATGTCACGGCCATCAACATTAAAAACAACTATTTCTCCAGTACGGATGGGTTCTTTGCTCATGCGCA
AAAAACAGGATATCACCCCTTTTGAATCCAGGCTCCATGCTACCAGAAAGAACCACGACCACCGGGGACTCACTCCCAGTCGCAACCATCAACCCCTTCC
ATATGATCAATGCCGACGTAACAATCATACCGAGGCTGATGATCTGCGCGAGCACCTGGCGGACCTGCATCGAGCGGATCGACTCCACCTGGTCGCCGAT
GAACCCCATCTCGCCCGGCGCTCCGCGGAGTGCTGCTGTCCACTtttcc
page-top