Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig1828
Contig Information
Length 714 bp
Tissue Dormant seed with water absorption
Clones 4 Clones [Download: CSV  ,  FASTA ]
whem18k01    whem6d09    rwhem6d09    rwhem18k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0831100 [Oryza sativa (japonica cultivar-group)] >gi|28372668|gb|AAO39852.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|31249739|gb|AAP46231.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|108711909|gb|ABF99704.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113550262|dbj|BAF13705.1| Os03g0831100 [Oryza sativa (japonica cultivar-group)] >gi|218194029|gb|EEC76456.1| hypothetical protein OsI_14178 [Oryza sativa Indica Group]
Score 639
Evalue 6.41106e-65
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig1828
GAACTGTTGGTGAAAAGCGAGCTTTTTGAGGTTCTCATCGAGACTTGCATTGAAAATGTTGGAGAGTTACTTAGAACAAACTTCGGCAAAGATGTATTAT
ACGAGGTTGCTGTAGGTGGAAAAAATAATGTCTTGGAGGGGGTCACCGACAGGGTCCACGTGCTTCACAATGCTATAGCTTCTGACGCAGCACGCCCGAG
GACAGAAGATGTTGAGCACGCCTTTGATAACTACCACTCGAGCCGCGTAATCAGAAAGATGATACTTGATTGCCCTGAGTTTGCCGCTACCCTATGGAAA
AAAGCCCTCAAAGGGAAGTGCAAGTCATTTGCAGATGGATTCAGCTCCAAGGTGGTGGCTGCCTATCTGGAATCTCCGGATTCCAAGGTGAAGGATCTTG
CGAAATCCGAGGTGCAGCTGCTCATCGACGGTGGCATACTGAAGAATCCAGACCATAAAGCAGCGGAGAAGAAGTGAGTCTTCTCTCGACGGGCCTCTCG
CCATCGCCAGCAACACAAGCAGGCCAAGGCGGCGTCCGTGCTTGCCTGTTGTGGATGAAAGAGTGTAATACATACATCCGTGGTCATCCTACTCGAGGTG
TATGTTCAATTTTGGCACTGGATACCAATGGACTCGAAATACATACAGTCGTTAAGGGTTTAGGTTAATACTTGACCTGTTACTGGGGAGGTTTGCTGCG
ATATATTCGTGTGA
page-top