Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig100
Contig Information
Length 793 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl46h10    rwhfl46h10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0244900 [Oryza sativa (japonica cultivar-group)] >gi|48716837|dbj|BAD23535.1| putative trafficking protein particle complex 6B [Oryza sativa Japonica Group] >gi|113630890|dbj|BAF24571.1| Os09g0244900 [Oryza sativa (japonica cultivar-group)] >gi|215692752|dbj|BAG88172.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704188|dbj|BAG93028.1| unnamed protein product [Oryza sativa Japonica Group]
Score 817
Evalue 1.80218e-85
Total Hit Count 180
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig100
cttttccgccgctcagctcgcttcctagatctctcttccacaggggaagtcgccgagGAGTAGGAGGGCGAGGGTATGGGGCGGGAGGTGTCGGAGAGCT
GCGTTGATGGGGTGGTGATGGAGATGGTGGCTgcctaCTGCGGCCGCTTCTACGCCGCCAAGCCGGAGCTCGCCGCCGGTCGCATTGAGGCCATCGGCTT
CCAGGTTGGCCATCAGCTCTCCGAGAGGTACACGATGGAGCGCCCTCGATTTACTGATCATCTTGAGGCAATCAAATTTATTTGCAAAGATTTTTGGTCA
GAACTGTTCAAGAAGCAGATTGACAATCTGAAAACAAATCATAGGGGTACCTTCGTTCTTCAAGATAACCATTTCCGGTGGCTTACTCGTGTTTCTCTAG
ATCCAGCAGTAGAGAGCACTGATGCAACTGAGAATGACTCTGGGTCATTGGGTGATTCTGCAGCCCAAACAACAAGCATGCTTTTATATTTCCCATGTGG
GTtgataagaggtgctctcacaaacttgggaattccgtgtgctgtctctgcagatatgtcaaaccttccagcatgttcttttgtggtgcgcataaagaca
tgatctgcgagaaatagaacaagtcagatatgaatgccggcctgtggttcaagtattttggacggtaaactaagaatgttcagatattttacttgactgt
attgtagtgttcctctatggtcaaatttcaaatatttgttgttattctgtgatgcaaggtactgtaaaatatttggtctggcgaatgcacgta
page-top