Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig10
Contig Information
Length 658 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl5n06    whfl5n06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0295000 [Oryza sativa (japonica cultivar-group)] >gi|113563968|dbj|BAF14311.1| Os04g0295000 [Oryza sativa (japonica cultivar-group)] >gi|215740456|dbj|BAG97112.1| unnamed protein product [Oryza sativa Japonica Group]
Score 249
Evalue 8.95472e-20
Total Hit Count 137
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig10
gtAAGGAAACGAGGAGAAATCGCAGATCGctatggcTACCCGCGGGCCGCCTCCGTCGTCGTCGTCGTCATCCGGATCCGTGACCGTGACGATCGACCCc
ttccccttttctcctcccgCCCCCGCGGCCGCTCCGCCGCCGCCGGAGACGGTGGTCCTGCGGCTGAAGCGGCGGGCGAAGAAGAAGGTGTCCTGGAAGG
AGGGGACCGTCGACAACGAGTCCCTCGGCCGCAAGAGCTCCAAAAAGTGCTGCATCTTCCACAAGGAGGTGCCCTTCGACGAGGACTGCAGCGACGacga
gGCGGACGGCGGCCGCCGGAATCCGCATGGGGACGCCGGGGAGGGGACcagcgGCGGCAAGGGCGGCTGCTCTTCCTCCTCCCACGGCCATGACCACGGC
CAcagacACCACCACTgagctccggttcgataggcAACTTCTGATGGGCCTCCTTGTCTacgctTGATGtcgtcaagggaAACATTGCTTCTGTGTgcca
agaactttaggtgaaaagctagttttaccatatcctcaaacttgcaagaggatgcaccttctatatcaaactgtactgttgcttacatgcaaactaatgt
tataagatgtataaatgaaacacctgttatcactgtcgcgattcggtgagtcaaaaat
page-top