Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1
Contig Information
Length 699 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhfl30l18   
Homology (BLAST) Top Hit Shaggy-like kinase [Triticum aestivum]
Score 884
Evalue 2.38107e-93
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1
attaccataaatacattcatacttctctagaacatattacagatcagccatggcaatcccaattctcaggcgagggttagtacaagggaggatgaaccgg
ttacattgtcaagcttgcatcgcagcatactactactcagctacacaggtcaattttgccgcaacatccgctgggattcctttcagttcgttaggcttga
agttaaaaagaggaggcagaaagcggctattcggaaggcgggtacccgggtcccgaagctcatcaaagaaggggtgaacaagtgcctcaacagcagtgca
tcttaggttgggcgagtactggaggagccgagagactagatcaacagcttcaggtggcatccttttatggaataccttgtgccatgggtgtgctttaatc
tgtgggaatttgaactctgtataatttgggttcatgcatttaatttcttcccttgtaggggtaccaaggaccttgatgatttcaacaagctggtccacac
cactttcaccaggaaacagaggctgccctagcataagctcagcaagaacacatccagcagaccaaatgtcaatggctgtagtgtactcagtagcaccaaa
tatgagctctggagccctatagtatcgggaacaaatgtatggatatgtttggttctcccttaacaagaacttttgcgctcccgaagtcacacagtttca
page-top