Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9995  (registered. 2012)
Contig Information
Length 1363 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_r Root 4
Wh_DPA20 Seed DPA20 2
Wh_SHC Shoot grown with cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218188615|gb|EEC71042.1|| hypothetical protein OsI_02761 [Oryza sativa Indica Group]
Score 638
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9995
TTTTTTTTTTAGATATGGACAGACCGCTCAAAACCTACTGCTTGCATAGAAAAATTTATGCTGTGCCATCCGTTGAGTAGCTCAGTAATCCCCGGAAAAA
AAAGCTCAGTAAGACGTGAAATGAGGGTATGAAAACAACAGAACGATGTGCAAGTGACGTGTATGTTCTTAACGGAACGATGACGAGGGAAGCCCACTGT
AGCAGATACTCTCTATATGTAGAGGGGATCAAGGGACACATAGGCGTGGCACCATCCATGCCTTCTATCTCAGCCACCATCTTTGTACTGCTGAAATTGG
CGTGTTGAGAAATGGCGTGTACCGAAGAATGTGAGGGTTTACAGCCCGGCCAATTCTCGCCCACACACTCTGGTGATAACCCGATGTTACAGGAGCATGG
TACATCAACTTCAACAGATGAAAGTACATGAATGTCTGAATTATGTTGCGTTTCCACGAGAAAAGTGATACGATCATAAGAAAGCCAAGGGTAATTTCAG
CATTTGAACAAAGGAGGCTGATCGTAGTGTTGTTTGTCTCCACCCACAAACAAGGCTCCTCCATGTACCTCCTGTAGAAAGAGGAGCGTGCAAAATTACG
CCTCAGGAATCTAGCAACATGATCAAGTGCCCAGCAAAGCACAGGCAGTAGAACAATCTTAAAGCGTACATTTGATGTGAACATCATAAGAGAGAACATC
AAATGAACAAAGTCCTTGGCTACAATTATAGACTGCAGCCAAGGCTGAATTGCAGGCATGTTCCATGCTCTTGGTTTCCCATAAGTGCAGTATAAAGAAT
ATGCTGACGAGCATATTGTTCCTAGCAACGAAAGTCTATATGCTTTGCTTGCGACATCTTTCGGTACAATTGGAAGGATTCCAAGACTAGCAACAATCAA
TACCCAAGCATTGATAGAGAAATGTATGGTTCGTCCATCGAACCGTAAAGAGTTTCCTGTCCTTTCTGTTGGTGCTGGTTGAGATGCACCAGTTGATCTC
GCACTAGATCCTGTGTCACGAGCTCGGGAATTCTCACTGGATGGTGTAGATGAAGAACTTGCTGCTGATCTGTTGGATTGAGTCGAACTTGTGGAAGACA
TTGGCTCAACCACCAAATCAGGGTCGATGTATCTGTGGTAGAACTTGCGCTTGAAGTGGTCGACGACGTCGGGGCGGGAGGCGAGGTGGGGCGGGACGAG
GACGTTGGACCAGTACCCCGCCCACCGCGCGTCGTTCTCGTAGTCGTACGCTCCCGCCGCGATCCGCTTCAGCTTCTGCGGGTCCCCGCCGCCGGTGCTC
TCGTCCGCCTCCCCCATCGCCGCGCTGGATCCTCCCCTCGTGCCGAATTCCTGCAGCCCGGGG
page-top