Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9977  (registered. 2012)
Contig Information
Length 784 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
WH_XA Root 1
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242069493|ref|XP_002450023.1|| hypothetical protein SORBIDRAFT_05g027180 [Sorghum bicolor]
Score 340
Evalue 1.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9977
TTTTTTTTTTGCAATTCCGTGCTTGTAACAGGCTACGGACATACCGGTTTGCATGGTAATAAATCTTCTGTTTGTCACATTACAACAGTACAGGTTCCTT
TACGATAACAATATATGTGTCTTTGTTCAAATAACTTCTGAAGAAACTAATCAACCATGTGATGTGAACCTAATGCCACTATGCTCTCATTTATGCGGCA
GCCAGTTTCTTGTTTGTAGATCTCAAACTACTTCTGAACTGTATCCTGATTTATGATGCCGCCATAATGCATTCAATTGCTTGCTTGCAGATGCCAGTCA
TTGTCTCTTCCGGTCCATACACCTCAATCGGAACACCGATTTCTGCACCAAGCTTGCGCATTTTCGCCAGTCCAGTTTGGTAATTTGGACCACCTCGTCG
AACATAGAGGTGCATCCTGGATGCCTTTAACTTGGATTCCTTCTCTCTTAATGCCTGAATGATGCCACTAAAAGTGGCAGCGACATCAGTGAAGTTGGCT
ATACCACCTCCAATGAGAAGGGCTCTCTTGCGGCCATCAGGGTCCGCAGTCACACAATCAAGTACTACTCTAGCATACTGCAGAACCTCCTCCTGGTTGG
GAGCACCACTGTATTCTGCATAATTTCCTAACTCTGAAGCATATCCCAAATCTCCAACCGTGTCAGCGTATATGACACTGGCACCACCTCCAGCAACCAT
TGTCCAGATGCGTCCCTTTGGGTTCAAAACTGTGAACTTCAAAGACGCGCTGGTCTTATCGTCCAGCTCATGGATAAAACTTTC
page-top