Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9965  (registered. 2012)
Contig Information
Length 1056 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14140122|emb|CAC39039.1|| putative plastid ribosomal protein L19 precursor [Oryza sativa]
Score 331
Evalue 8.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9965
CCTACTATTTCATAACCACTGTTCTTTCATAACAGCAGCGTTACGTACTGTTAACCAACAGTTGGGACTCCGGTGGGTAGCTGGGAAAGGGCGCAATAAA
CATCATCATATTCATACCGGAGCGCTGGCAGGAATTTTATACACTCACAAGTACACTCCTCCCCCACAAGACGAAATATATGCCAATCGAAAAAAAGATG
TAAGATTATGCGGCTCGAGGTTCAGAGATCATTACAGTGGATGCACAGATCTGAATAAGATTGTGGAAACTCGTTTGCCAAGGAGAAATCGACATGCTAG
TGTGAGAAGCTGCGTGTCTAATCTCACTTGAAGGTTGAGAAACGGGGAAGCTTGTACTTCAGGTAGTACAACTTTGCCCTCCTCACCTTCTTGTGTCTGA
TTACTTTGATCTCCTTGATCCTTGGTGAGTATATGGGGAATGTAATTTCAACTCCAACACCGGCAATAATCCTCCTGACGCGGATCGTGGTGTGAACACC
AGATTTGTGCTTTGCAATGATTATACCCTTAAAGAGAGACAATCTCCTCTTGTTTGGACGTTGCATTCTAAGCTCGATAATGTCACCGGGCTTCAAATCC
GGAAGCACTTTCACCTTCTCAGCCTCCTCGATGAACTGCTTGTTCAGAATCCCGATGATCTCACCGAACTTAATCGGCTTGGGCCTCGGCGCCGGCTCCT
CCTCTTCCTCCGCCAATGCGACAGCCCCCTCCGCCTCCCCCTCCTCGGAGTCAGCAGAGGCAGCGACAGGCTCGCCCTCAGGAGCAGGCTCGGTCGCGGG
CTCCGGCTCTGCGGCGCCGGCGTCTGCGTGGGCGACTAAATGGGTGTTCCGGCGATGGGAGGTGGATAAGGAGAGGCGGCGGAAGGAGGAGGACAGCGCG
AGGAGCTGCGGCGGCGGAGGCGAGCGGTGATTTAATAGTGCGTGGGGAAGAAGTGTGCCGGTCGCGGCGGCGGCGGTGGCGGCGGCGGCCATCGAAAGGT
CAGGCGGGCAAAGATGTCAGTGCCGTCGCATGGGCCGGAGGAAGAAGCGAGAGAGG
page-top