Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4466  (registered. 2007)
Contig Information
Length 872 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0553800 [Oryza sativa (japonica cultivar-group)] >gi|49328026|gb|AAT58727.1| putative anti-silencing protein [Oryza sativa (japonica cultivar-group)] >gi|113579816|dbj|BAF18179.1| Os05g0553800 [Oryza sativa (japonica cultivar-group)] >gi|215737312|dbj|BAG96241.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197236|gb|EEC79663.1| hypothetical protein OsI_20908 [Oryza sativa Indica Group]
Score 831
Evalue 5.02163e-87
Total Hit Count 202
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4466
CTTAACGAACGTGGCGGTGCTGAACAACCCCACCTCTTTCGTCAACCCCTTCCAGTTCGAGATCTCGTACGAGTGCCTCGTCGCCCTCGAGGACGATCTG
GAGTGGAAGCTTATATATGTTGGATCAGCTGAAGATGAGAACTATGATCAGCAACTTGAGAGTGTGCTTGTTGGCCCTGTGAATGTTGGGACATACCGTT
TTGTTCTGGAGGCCGACCCCCCTGATCCCTCAAAGATCCGCGAGGAGGACATAATCGGGGTTACAGTGCTTTTGTTGACCTGTTCATACATGGGGCAGGA
GTTCATCAGAGTAGGCTACTACGTGAACAATGATTACGATGATGAGCAACTTAGGGAAGAACCCCCAGCGAAGCTGCTGATTGACCGGGTGCAGAGAAAT
ATTTTGACCGACAAGCCCCGAGTCACTAAGTTCCCCATCAATTTCCATCCCGAAACCAGCGGAGGACAGCAGCAAGATCAGCCACAATCAGCTGTACCTG
AAAACCAGACAAGCGAAGGGAGCAAGGCCAGCACAGATCTTTGACCTGGTCTGGAAACTTGGGAATGCCAAAATTTTGATCTGCATGCCTTCTAGGTGAG
ATTGCAATATCAGATGGCTTCCTGGGATGCTGCTGCTACCTGAACCGTCTGTTCTGGTGCGCCACTAAACTAGACTATAGCCAAAAACTCACATTGGTTA
GCCATGTGCCTGTGGTGGGTAGGTAAGGTTCTGACACACTGCGTCCTTTTGCTAGTGATGAACTGTAAGCTGGATGTTCATCCAGTGATCCGGTGCAACC
GTGGTTGTCTTGTCTCTTGGATTATGTCTGCAGTCGCAAGGGTTCGTTAGATGACTTTGGTCGCCCATAATC
page-top