Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4437  (registered. 2007)
Contig Information
Length 272 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative accessory gland protein [Gryllus rubens]
Score 76
Evalue 4.60323
Total Hit Count 2
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4437
TGAAGACGTCTTATCCTTCTGTTATATCGTTTCCATTTTCAGCATGTGTATCTACAGCGGGCGTTACGGGCCCGATCTCCAAGAGTTGCTTTGTCCTTGT
CTTCGTGTACCATACGAACCTGCACAGTTTTGGATCCTGTCTGTATCAAGGGCCGTGAGGTGTATATTGAGGGCAATGATGGAGATTGTTATTATACCCC
TTGGGCCTTTTCTGCTTGGTCAATTGAGCGTAGGCTGCAGTATATAATGAATAGTTGAGATGAAAAAAAAAA
page-top