Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9957  (registered. 2012)
Contig Information
Length 832 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035815|ref|XP_002465302.1|| hypothetical protein SORBIDRAFT_01g035860 [Sorghum bicolor]
Score 353
Evalue 2.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9957
TTTTTTTTTTGATACTAGAAATGATATTCATAACTGGATTGCAAGCATGGTCTCAAGTTGCAAAATACTGAAACAAGAATGAACTGGTTCTGAATACTCA
TCGACACAAGACTCTGACATCTAAAGCAGTATGATTCTGGTACCCAAAAAAGTGAAGATTGACCGATAACAGCAAATGTGACAAGGGTGCCGAAAACTCC
ACGGCTTAAACCTTGAAGCCCCTGCTGTTCCTCCTTCCTCTTGCCTTCTCGAATTTCCTGCCCTTGGAGCGGACATATGGCTTGGTGTGGCTGTGTGGCA
CTCCTGGAGCCTTGCCAAAGTGCCTAACAGCCTCCCTGGCGTTCTTGGGACCCCTCAGGAGAAGCGTGTTCTGTCCAAGCGGAGCACGGAGCGCGAGCTG
GTCAAAGGTAAGGCACTCGCCACCGGCATTGACAATCCTGGCCCTCGCCGTCTCGGTGAACCTGAGCGCGGCCACCTTCATTGCCGGTATCTCGTAGACC
CTCTGGTCATCGGTGATGGTGCCCACTATCACAGCGATCTTGTCCTCCTTCCCCTCCATGAACCTGACGAGGCGGCGCATCGAGAGCGGGGGGCGGTTGG
TCTTGCTCATGAAGAGGCGCTTCAGGATCACGGCGTTGAACTGGCTCTTGGTCCTCCGGACCAGGAAGCGGTAGAGCTTGACGAGCAGCTTGAGGTACAC
ATCGTCCGATTTGGGCGCCGTGCGCTTGGTCCTCTTGTTGCGGCCGCCGGCGACGAGGTCGATACCCATGGTTGCGCGGTGGAGGCTGCAGCAGCGGCGA
GGGTCAGGGCGGCAGCGGCGGCGGCGGGACCC
page-top