Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9945  (registered. 2012)
Contig Information
Length 1288 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_SH - 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_SP 12
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196507|gb|EEC78934.1|| hypothetical protein OsI_19367 [Oryza sativa Indica Group]
Score 591
Evalue 6.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9945
TTTTTTTTTTGGCAAGACAATAGACAACCGCATGCAATATAAAGCATTTATCAACTCTTCTGTTAGAAGTATGTTGGTACCATCAGGTATCAACTGGCAA
AAAATATTTGAAAATAACTGCTCCTTGGAGAAATGCTTTTGCAGCAGAGGAAGAAAACAAAAGAGATTGTACCCAAGGTATGATGGGAGACAACCCTAGT
AGCAAAAATATACAACGGAAGCCATTATTTCAATCGCTTCTGCTTAAAGCCTCAACGTTGCAATAAAAAGAAGAAACAATGGTCATCAGTTGACGACGTC
CAGGACCAGCTTGCGGGACTTGAGGACGGACCACCTCATGCGACGGTAGTATGCGGCTTGGAGAAGAGCAAGTGACAGTAGGAAGATCCATTTGACACCC
ATCAGTTTCCTCTCTTCCATTTCAGGCTCAGCAGCCCACGACAAGAATGACACAACATCCTTGCCCATCTGGGCTTCAGTTGCAGGAGTACCATCTTCAT
ACTCAATAGCCCCATCCATAAGCATCTTAGGCATGGCTATGGCACCACCAGGGAAGTAGGGATTGTAATGCAGACCCTCACGAATCTGAACACCAGCAGG
TGGGTCATGGTAACCAGTAAGAAGAGCAAACACGTAGTTCTGGCCATCGTGCCTTGCCTTCGTGATAAGGCTGAGATCTGGGGGATATGCCCCACCATTT
GCAAATCGGGCTGCTTGTTCATTTGGATAAGGCTGCGGGAAGCGATCACTCAGCTTGCCAGGACGTGTGAACATTTCACCCTCATCATTAGGACCATCAA
CCACTTCAATTTCAGCAGCCATTGCCTTAGTTTCCTCCTCAGTATAGGCCACCCCAACCAAATCACGGTATGAAATCAATGACATGGAGTGACAAGATGC
ACACACTTGCTGGTAAACTTGATGTCCACGGCGGATTGATGCGTGATCATACGAGCTAAGGATGCCAGCATGCGGCCAGGGGTACTCTGCAGCTGCCAAA
CCATGCTCAGCTTCATCTGCAGATGCTATCGTACCAAAACTTAAAAGACCAGAAGCACCAACTCCAAGAAGAGCCAATGCTCTCAGTCCAGCAGAGGACT
CTTCATGCTTTCCCCGAAATGAAGAAAGCAGAGATGAGCCAGAAGACTGGCTCTGAAGAGTTTTCCTCAGAAGCTGGTTAATGCCCCTGCCGGCAGCCAT
TCAGGGCTCGATTGGGAGCGGACTTGACACGGCGAGGCGGGGCTCCGACGAGCGGCGGCGCGGGGGGTGGGGAGCGGGTGGGAGGGAG
page-top