Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4262  (registered. 2007)
Contig Information
Length 901 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016419 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 119
Evalue 1.64772e-06
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4262
TCTGAATTTTTAGCCATGCTTTCTTAGCTCATGAAGGCAGGAGCATATGTGATTTTTCTGTACCACCTTCCCGCGGCTCTGAGGATTTTGTCTGCTCGCT
GCCTCTCCGCTATTTATTTGTTGTGTCTACTGCATTGTTTGTTCTGCCACCCTTTTCCTCAGTTGCTAGCGGGGGGCCTTGGCTTATCGTATTGTTTGTT
GCCTTCCTCTCATAGGTTCGTTGGTATTGTAAACCATTTTTGTTGTAGTAATAACTACAATGTCAAATAAATTTACATTTCACCTTGCTTCCACTATTAT
TCAAGTTTTTCCCTGCTTATTGGTCGTACTAGCAAGATGGTTTTTGTTTTTTTACCGTGTCTAACATAGTGTATTTCTACGATTTTTCTCTGTTAAAACA
TATCCACTTCCATGCTCTTTTCTCTATTTTAGTACACAATAGTATGGCTGCATACTACCAATTGCAGAAATTATTCATTTGCCACTAAAATATATATTTT
CCTATTCACAAATTAAATAACAACAAAGATGAAGTTGGTCCCCGGATGCCTAATATGTTCTTTCATATCCTGGTCAGTTTACCAGGTAACAGAATTAATA
CTTCTTGTTGGTTCAATAGTCAATACCAGTGTTGTGAGAAAATTCCTTACGGTTGTTGTATTTTGGTAGCTTCTTCTTTTGCAAGTGGCAAATTACTGTT
ATGTATATGTGGAATCCTATTAAATCTGTGCATTGGTTTCAGTCATACTTTTCTAAATGGAGTATAGTTCAAGACTGTTTTGTTCATTAAATCATTCCTT
CTACCTTCCAAGTGTGTCGNTGGCACACCTCAAATTACTTCNACTTATACNTGNATTCNNTGNNNGGCGGCTCGANCCGCTCCNGGATCGGGAGAGGAGG
A
page-top