Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig992  (registered. 2012)
Contig Information
Length 768 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XA Root 1
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|193848563|gb|ACF22748.1|| proline-rich protein [Brachypodium distachyon]
Score 177
Evalue 1.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig992
GGAATTCGGCACGAGGCGGTGGCGGATCACGAGGGGCGGATCAGGCGGGCGCGCGCGGTGCCCCATCGACACGCTGAAGCTGGGGGTGTGCGCCAACGTG
CTCAACGGGCTGATCAACCTGCAGCTGGGGACGCCGCCGAAGCAGCCGTGCTGCTCGCTAATCCAGGGGCTCGCCGACCTGGAGGCGGCGGTGTGCCTCT
GCACGGCGCTCAAGGCCAACATCCTGGGCATCAACCTCAACGTGCCCATCGACCTCAGCCTCCTCGTCAACTACTGCGGCAAGAACGTCCCCTCCGGCTT
CCAGTGCCCCCGCTAGAAGAGAAGACCCGAGAGATCCATCGTCCACTGCATGCAGGCATCCACTATACGTACGTACGTGCATGCACGCACGCATGATCTA
CAATCCATCCATTGACTAGTGCTCTATAGCTAGTCGTATACGTTATTTGCTTCATAATTTATCATCGCTCTTGCTAGTTGCTAAACTTGCATATTTCTCT
CTGTGTGTGTGGTAGTACCGTTTGTACCACGTACTGCTTGTCATCGAACTGGTTACGGTACTCTATGGACCATGGATCCAGTTCTCAGCCACATATGATC
TCATGCGTGTACCGCTGGCTGCTATTATATTTCCTTCAAAAAGAGGTTGCTCCTCCACAATTGTAGTAAAGTAATTAATATCATATGTCAACTGTCTCTG
TGTGATCTTTAGCATTTGCTAATTGATTCGATTAAAATTCTGTGCGCCTTTGATTCTTAAAAAAAAAA
page-top