Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9916  (registered. 2012)
Contig Information
Length 917 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218191541|gb|EEC73968.1|| hypothetical protein OsI_08869 [Oryza sativa Indica Group]
Score 330
Evalue 2.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9916
GGCTTGATACGATGGCCCGGAGGCCTGCTGATCCTGAAGAAGAACTCCGATGGATGTCACAAGAAGTTCGTGGTTATGTCGAGGCTGTGTTGAACAGCCT
GGCAGCAAATGTTCCAAAGGCTATTGTGCTTTGCCAAGTGGAGAAAGCAAAGGAAGATATGCTAAACCAGCTGTACAGCTCAATAAGTTCACAAAGCAAT
GCAAGGATTGAAGAACTTCTCCAAGAGGACCACAATGCTAAACGCAGACGGGAAAAGGCCCAAAAACAATCGACTCTTCTGTCAAAACTTACTCGTCAGC
TCAGTGTCCATGATAACAGAGCTGCAGTTGCATCATATTCTGATGATACTTCTGGTCCGGAGAGTGGCCCACAGAGCCCTAGCCAGTCGAGTGAGGACTG
GAGGTCTGCCTTCAGTGCTGCAGCAAATGGCTCTGCCGACCGATCCAGTTCACAGAACGAGTCAAGATCGAGAAGTGCTGACAGTCGTGGTCGGCGGTAT
GAAAATGGGGATGCCAACGGTGCCAATTCAGGCAGCCGACGCACACCAAACCGGTTGCCACCTGCACCACCGAAATACTAAGCATGTTGATTGGCATATG
TGAGAATCCTATTTTTCATGGCATGCTCTCACTCCCACCTGATAGTGATGGGAAAACAAATTGGAATGAGAATAGAGAGCTGGCGAGAGATCGCATGAAT
GGTGTGTATCCAGAGGACCTCAGTTGTTTATAGAAATATGTAGGTTATCTACGGTGGTTGTTTCGCGATCATTTTGCTATATCGATCAGTCTGATGCTCT
CTCGGCCTGTGAGATTTTGTTGCCACAGATCAGTTGATCTTGGTTCTGAACTCTGTTGTTGTAACTTGTAAGTCTTCCATCAAACTGGCAATGTATCCTT
TTCACCCAAAAAAAAAA
page-top