Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9914  (registered. 2012)
Contig Information
Length 914 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig9914
TTTTTTTTTTCAAAGCGTGGATGGACAGATATTGCCCTTTGTGATCACAATGAATTAATTCGACACTTGCTCCTCTCTTACACACTTGAAATGCTTTTTT
CTAGAGAAGAGGCGATGGCCGAGCCTTGGGCTCGAACCTAGCCCGGCTTTGAATTAACAAAGCCATCAACCGGCCACGATTACACCACTTACAAGAAAGG
AAAACAGGGAACGACAAAGATACGGAGTGCTACAACAGCTCATAGCCAACCAACAATACAGGCAAGCGAAAGATACAAGAAGGAGCTCAGCCTGAATTAC
CACAGCCTAACATCTAGAACAGCAGCTAGCTCGGCCACAGGAGAGAATCAACCAGCAGCACCAGCAACGGTGGCCATCGCCACATCGCCTACTCCGGCAG
AACCTGCTAGCAAGCCATCTGATTCCCCCTCCAAAGAGGACCACAATCTTCTCGCCCTGGCTCGAAGGGCGTCGTACCGTCGGGAGGTAGGAAGCTCACC
GAGAGCCGCATGAACAAAACCAACAGAGCACCTTAGGCAAGAGGAACCAGAGCTCAAACCACAGCCGCAGCGCTCCCACGACCTCGCCACAAGCACAGCC
AACCGCACATCCAAACACGAGCTGAAGAAAAATACTGCACAACGAAGACCGGCGGAAGAAGATGCACAGAAAGCCGCCACCAACCGCAACCAAACCTGCA
GCAAACGCCAACCTTGCTTCCATGCACCCCGGATGGTGCCTCCAGGAAGGGATGCGACGACAGAACGCCGCCACCGTCCTCAAGGGGAGCTGGAGCTTTC
GCCACAAGAATGCAAGACGACGGGAGGGAGGGGACCTCGACAAGGCCTCCAAGAAGGTAGCCGACGCCAATCCATGGCGTCGCCATTGTCCTGGCCGCCG
CCGATGACCAAGGG
page-top