Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3976  (registered. 2007)
Contig Information
Length 916 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010322 [Oryza sativa (japonica cultivar-group)]
Score 695
Evalue 3.24203e-71
Total Hit Count 339
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3976
AATTCAGTAGCAATTCCACCTATCTTGACAAATCATACAATATAAAGTAAAAAAAAAAGATCCACAATATTGATTAACTGGGCCCACGTAGGNGGAAGAT
TACATTTTTCTGGGTACAAGTTGAAGAAAGCCGCACTTACTAGTTCAAAAATGAGGTGCATGCTGCACTATAAAACACTATACTAATCTTACCAGCAGAA
GAATACCCTTTAATACCGAATGTGGTGGATTTTCCGTAGATGATTGGTTTATGTATCAACTATGGTACAGGGATGCTTTTGCAGCTTGGTGGAGGCAGCC
ACACAAATGATTTTCTGTAGATGGTTGTTTTATTATGTATCAACTACGGTAAGAGATGCACAAGCTGCAGCCACACAAATGATACATAGCCATCTGAGCT
TCGGAGATGATCCTATGTGCATTGTACCAAACAAACAGGATCCACTTCCCTCAGCAGAGGCTCGGATAAAATTGGGAAGAACCCTTCAAGGATTCAACAT
CATCAATTGCAGTCCATGACTGCTCTTGCAGCTTGGCAGCCTCAGCAATATCCGAGTTGCAACCATACACATGTATTGCCAATCGTCTACGTGTTGGAGA
AGATGATCTTATGTAGGTATTGTACCAACTGATGACGTCCTCCTTCCCAACTGTCCTTAGCTCTTCAGCTTCCAGTTTTGACATATCAAACATATACCTT
TTGTCGGTAATCTGCGACCAGTAATCACCAGTTTGATAGCTAAGGGAAGGATCCTTCTCAAGTTTTTGAGCTATTAGCCCACTCTTGTGATGCTCAAAAG
TCTCCTCCTCAAGCCCATCCAGCAAAGCAGACAGACCATCAATAAAGTTATCAATCCTGCTTTGCAGGTAAACAGGGCTATACTTGGAGGACATAACCTC
GAAAAACAATACGCCA
page-top