Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9874  (registered. 2012)
Contig Information
Length 889 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XC Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242062364|ref|XP_002452471.1|| hypothetical protein SORBIDRAFT_04g026360 [Sorghum bicolor]
Score 350
Evalue 9.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9874
CAGTTTGTATGATTGTAACAGCTTAGACTGCGCAGTTAAGATGCAAGATGCAGTAATTGACAGGGCAAATGAAGCGTCAACATGTACCGTGTTGATCCGC
ACAAAACAGGTAAATCCTACTTGAACTTCATAACAGTGGCTGCTCAATTTTGTGCCCATATAGGTTTATTAACACAAAGATCACAAGTTTGAAGGAAAAC
TCAAAGTGGAATCACTCCACTTCAAAAAAAATATACTTCAAGATTTCGGCCCCCAAAATCACCAAGAGAGCACCACTCCTCTTGTACCAGTGAAAACAGA
ACTTTAGACTGATATGGTACAATCATTAATCATTTGACTGATGCTTTTACAGCCTTCTCTGCAGCATCATCAAGATCCTCTGCAGTGATCAATGTCATTC
CACTTTCCTTAAGAATCCTTTTCCCTTGGTCTACATTGGTGCCTTCTAGCCGAACAACAACAGGGACCTTAAGATCAACCTGTTTAGCTGCATTCACTAT
TCCACTTGCTATCACGTCACATTTCATGATACCTCCAAAAATGTTCACTAGAATTGCCTTCACTCTATCGTCTGAAGTCAATATCTTAAATGCTTCCACA
ACCTGTCCCTCGGATGCACTCCCACCAACATCAAGAAAATTGGCAGGTGTACCACCATGCAGCTTAATGATGTCCATCGTAGCCATTGCCAATCCTGCAC
CATTCACCATGCAACCAATCTCTCCATCAAGCCCGATGTAGTTCAAATCTGCTTTAGCAGCAGCCACCTCTCTGGGGTCCTCCTGTGTTGTATCACGCAG
TGCAAATATTTCTTTCTGCCTAAACGCAGCATTATCATCGAAGTTCAACTTTGCATCAGCAGCAACTAGCTTTTTATCAGCCCTCGTGC
page-top