Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3534  (registered. 2007)
Contig Information
Length 774 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0182500 [Oryza sativa (japonica cultivar-group)] >gi|113578370|dbj|BAF16733.1| Os05g0182500 [Oryza sativa (japonica cultivar-group)] >gi|215767278|dbj|BAG99506.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196214|gb|EEC78641.1| hypothetical protein OsI_18725 [Oryza sativa Indica Group]
Score 444
Evalue 1.63819e-62
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3534
CCGCGAACAACCTTCTGCACCCCGATCCGGTTCGGTTTAGTTCGCTGGCGTCTCCACCCGATCGACTCCACTGCAATATGCTATAGCCCGTGGAGCCTGG
GGCGTTGGTTGTACGGCAGTAGATTCCCGCGGGATCTGCCGGGGCGCCCGGAGCCGGAGAAGGCGACGATGTCAACCCCTGCAAGGAAGAGGCTGATGAG
GGATTTCAAACGACTGATGCAGGATCCTCCTGCGGGCATAAGTGGCACACCTCAGGATAACAATATAATGCTGTGGAATGCTGTAATTTTTGGTCCTGAT
GATACTCCCTGGGATGGTGGTACGTTCAAGCTGACACTTCAGTTTACTGAAGATTATCCTAATAAGCCACCTACAGTGCGGTTTGTTTCTCGAATGTTTC
ATCCCAATATCACTGCTTTGCGACCCAAACCCAAATTCACCTGCCAACTCAGAAGCGGCCCGCCTATTCAGCGAGAACAAGCGGGAGTACAACCGTAAAG
TACGTGAGGTCGTGGAGCAAAGCTGGACTGCAGACTAAAGTCGCTGCATCCAGTTGTGATGCCAGCTAATTGCCCGTTAGCGCCTTGAGTCCTATGTACT
GAACTGCTTGCAAGGTAATTAAAATGTTACATCATGCTTGTTGTCGTGTATGTTGTTGGGAGTGACATTTTTAGACGCTCAGGATGGAGATTATTGTATC
CAGTCTACATATAACATACCATGCTGCCTTTGNAATCANATCGAGCACAATATGGATTTGCTATAAAAAAAAAA
page-top