Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9861  (registered. 2012)
Contig Information
Length 844 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502949|ref|NP_001149726.1|| 60S ribosomal protein L5-1 [Zea mays]
Score 390
Evalue 1.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9861
TTTTTTTTTTCCAGATCAACAAACTCTGAAACAACGTCAAAATCCCAGCACCTTGTATAATGTAAGATAATCCAAAACTCCAGCATGGTACTCAAAACCA
AGAGGCAGGTACAATGTGCATATATGTCTCTCTCGCGATACTACTGTTTAATGCCGAGCAAGTTCATTTGGAAGCATGAAGACAGCACTATAGGGGGCCT
AGGGTCGATTACACTCATTCATCGTCGTCCTCATCATCATCAGCACCAGCAGATGAGTTGAGGGCGTTGAGCCGCTCTACAAGATTGGCCTTCCTCTGCT
CATAGGTCAGCTTCTTGGGATTGTACCTCTTGTGCGTCTTTGGAGGTTCCTTGGTTGACTTTGCCATGGTAGGATCAGCACGAATGGCAGCATGAACCTT
CTTGTACAGTGATTCCATGTTATCAGCCTCAATCCCCTTCTTGATGTACTCACTGAAGTGAGATTGGTACTTCTCAGGTTCCTCGTCAGCCAGTGACTTC
ATGTAGTCAGCAACATGCCCTCCATAGATGTATTTGCGGTGAATCTCAGCGTCCAGCTGCTTCTCGTCCTTCTTGAAGCCAGCAAATCTCTTGTCACTGT
GCGGAATATCAAGACCACCATCCAAAGCTCCCTTGAGGGCACCAAACACACGGTTTCCAGTAGTGGTCCTAATAAGGCCAACATCCAAGAGCGCGCGGAA
AGGCCTCCTCTCATCAGCCGGCTCAACAGAGAAGTCCTCCCCAGTGGCCTCAACATTGCCCTCATATTCCTGATCCAAATCACGGCACTTGAGCACACGG
CGGGCCAAAAGCAGACCAGTACAGTAAGCTGCAGCATAGTTGGT
page-top