Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9840  (registered. 2012)
Contig Information
Length 978 bp
Clones alternative view 98 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 5
Wh_r Root 5
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 10
WH_XA Root 7
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 9
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|232033|sp|P29546.2|EF1B_WHEAT|EF1B_WHEAT RecName: Full=Elongation factor 1-beta; Short=EF-1-beta; AltName:
Score 412
Evalue 2.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9840
TTTTTTTTTTATCAAAGACTGATTTTACTCCACATGATAGATGTTTCGCCATTACAAACCGCTCAGCAGTTCAACTATTTAAAGGTAGCAGACATTCAAG
ACCAGGGCATCACTCAAAAACAAAACCAGTAGCATTTCTGTAAGAGGGGTAACTAAATGGGACGACATAATGTTTTCCAGATCGACCAATCCCAGTACCA
AGAATCCAGCAGGTGGGAGAACAAAGATTCTAGATCTTGTTGAAGGCAACGATGTCACACGACTGGACATATTCGTTGATGGGCGCCTCGCAAAGCACTT
CCTCAATAAGAGTGTCGACGGACACAAGGTCATCGATGATCGTCAGCATGATCTGGAGCTTCTTGATGCCATAACCCACAGGCATAAGCTTAGATGCACC
CCAGGTGAGACCCTCCATTTGAACACTGCGGACAGCCTCCTCCAACTTCTTCATGTCAGTCTCATCGTCCCATGGCTTGATGTCCATGAGGACGGAGGAT
TTGCCACTTTCTTTCTTCTTTGCAGGCTTGGCAGCCTCACGCTCAGCTGCAGCTTTCTTGTCCTCCTCGGTCTCATCGCCAAACAGATCCATGTCATCAT
CGTCATCTTCATCCTTGGAAGCGGCAGGAGCAGCTGCAGCAGGAGCCGATGATGCACTCACCCCAGAGGACTGGCCAGGGAACCTTGAAGCAACAGCCGC
GGCGACGGTGTCGTACCAGCGGGCAGCGTTCGGGAACTCGGCGCTGGGCTTCACGGGCACCGCCGCGAACACCTTGACGTCGTCCTTGGTGATCCCATCG
CCGGAGATGTAGGTCTTGCCGGCGAGGTGCGCCTCGAGGGCCTTGAGCCCGTCGGCGGTGTGGAGGTCGGAGAACGTGACGGCCATCGGATCCGGCGAGC
TCGGGGGCTTGTCGAATTCGCTGGGCGGCGGCGGCGGCGGCGCAGGAGGCTAAAGTCCCCCTCGTGCCGAATTCCTGC
page-top