Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3105  (registered. 2007)
Contig Information
Length 180 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192876 [Zea mays] >gi|195644624|gb|ACG41780.1| hypothetical protein [Zea mays]
Score 96
Evalue 0.0218261
Total Hit Count 9
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3105
GCCGGCCGGGGCGTCGCTGGACATGCGCGAGGTGAACGGGCTCGCCGTGCATCTCAAGTCCGGCCTGCCGCTTGTCGCTAAACTGCGGTTTCGTTAGATA
AACTTGTTGCTATGCAAGAAGAAACTGTAAAAATCTGTAAAAATGTATTGTAGTGTTTGCTTCAAAGCCTAAAAAAAAAA
page-top