Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9824  (registered. 2012)
Contig Information
Length 886 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 7
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471698|gb|AAW50980.1|| ribosomal protein L36 [Triticum aestivum]
Score 223
Evalue 2.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9824
TTTTTTTTTTGGGGGTATGGGCTCCAAGTTCACACCGTGGCAGGGCTTTCTGAAAACATATAACNNTCGCAGGTACAAAACCCAGACAAGCTACATAACT
GAATAAACAGCAGAGTACCAAGTAATCAAACAAAGGCACCAGACTCATGTAAAAATCTTAAAAAGATTGGTCTTCTCAAAATAGAAACCACGGGCTAAAG
ATAGTGTCAACACAATGGCCATAGCTCTATAGGTACGGACTGGTAATACAGGACTTTGCTTCCGGATAAAATTCACCAGCTAGCCAAGTTCTATTTCTTC
TTGTCACCAGCACCACCACCAGCAGACCTCATCTTCCTAAGGACACTTGACATCTCCTCTCTCTTCTTCTTTGCTCTCTTGTGAGTACCAAGCTTTCTCT
TGGCGACCTTGAGTGCACGCTTGTCCTTTCCAACCTTAAGAAGCTCAGTGATACGCTTCTCATAGGGAGCAAATCCAGCAACCTCCCTGATCAAGTTCCT
GACAAAATGCACCCTCTTTGTACCTTTCCCCTTGCGGTCGGACGGGCGAGGCGGCAGCTCGCGCTTGGTGACGACGTGGCCCTTGTTGATGCCCACGAAG
AGCCCTGACTTGGGCTGCGACGGCGCCATGGCCGGACTCCCACTCGCTCCTGCTAACGTTGAGAATGGATGCAAGTGAAACCCTAATCCGCCCTCGTGCC
GAATTCGGCACGAGGGTTGAACAACACCATATGAAATGTATTGTCAACAGTATACAAAGGAATACTCGTATGCATATAGACAGCACGCACCAATCTTCAA
GTGGCTTGCAGTACATACCGGCTCCGGTAAAAAGTGGCTTGCAGGCCGCGCACTTCGTCTATAATAATCTGCAATACTACGAACTG
page-top