Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3069  (registered. 2007)
Contig Information
Length 1436 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic; Short=RuBisCO activase A; Short=RA A; Flags: Precursor >gi|167097|gb|AAA63164.1| ribulose 1,5-bisphosphate carboxylase activase isoform 2 [Hordeum vulgare subsp. vulgare]
Score 1870
Evalue 0
Total Hit Count 186
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3069
AGCCGCGCATCCACCGTTGCTAGCAAGGTCGACCAAGCAGCACCGAGATGGCTGCTGCCTTCTCCTCCACCGTCGGTGCCCCGGCTTCTACGCCGACCAA
CTTCCTCGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCTCCAAGGCCAACAGGTTCACAGTCATGGCAGCGGAAAAC
ATCGACGAGAAGAGGAACACAGACAAGTGGAAGGGTCTTGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGAGGGAAGGGCATCGTGGACTCCC
TCTTCCAGGCGCCCACGGGCGACGGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCAGGGACTCAAGAAGTACGACTTCGACAACACCAT
GGGAGGCTTCTACATCGCTCCTGCTTTCATGGACAAGCTTGTTGTCCATCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGATCCCACTCATCTTG
GGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAGTGTGAGCTTGTCTTCGCCAAGATGGGCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGA
TCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTTGACGCCGGTGCGGGTCGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGT
GAACGCCACCCTCATGAACATCGCCGATGCCCCCACCAACGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACT
GGTAACGATTTCTNGACGTTGTACGCCCCTNTGATCCGTGATGGCCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCA
AGGGTATCTTCCAGACCGACAATGTCAGCGACGAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAACATTGGCAAGAGGCTGGTGAACTCGCGGGA
CGGACCCGTGACCTTTGAGCAGCCAAAGATGACAGTGGAGAAGCTGCTAGAGTACGGGCACATGCTTGTCCAGGAGCAGGACAATGTCAAGCGTGTGCAG
CTTGCTGACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCTTCTACGGTTAGAACATTCTCCATACACACC
CACCATCTCTTGCTGCATAGGAGGAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTACCGGCAGGATGCACCGACCAGACTGCCAAGAACTTCGACCCA
ACGGCGAGGAGTGACGACGGGAGCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATGTTTTATCCTTTGTACCTAAGTACCGCATCGCATCC
AAGCGATTGCTGGGCATGTTTTGTTAATAAAAAAGA
page-top