Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9803  (registered. 2012)
Contig Information
Length 660 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_SH - 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242063294|ref|XP_002452936.1|| hypothetical protein SORBIDRAFT_04g035260 [Sorghum bicolor]
Score 216
Evalue 2.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9803
TTTTTTTTTTGATATAACACTCAAACATTGCAAAACAGTCACAAACTCATGACAAATTACGCTTTAGTGCTGATATAGAAATATACTAAAATGGTCCGCA
CATTTGACAAACAAGTCTAGCCAAAACTTCCACAGGTTCTCGGAATACATGATCAGTTTCGGTTGCCAACATAGCATAGATTCACCATAAAATGACATTT
CTCAGCTCATGACAATCACAAGAAACAAGCATTACTGTCCCTAGATCAAAAAAACCTTAGATGCTGCTCGGGTACATGAACACCCTGACCTTGCGCCCCA
TGGACTCGGCGGGGAGGTTGGACTTGAACTGGGCGCGGACGACGCCGGAGTTGCCGTGCGGGCGGGTGATCTTGCCCCAGAGGCAGCGGTAGTGGGTGCC
GTTGCTCTTGGTCTTGGCCTTGTAGACATACGCCAGGCGCTTCCCGGCGTACCACGCCACGTCCTCCTTGGTGTTCACCCCCTCGACCTGCACCAGCGAC
GTGCTCTCGTACTGGTTCGACTTGGACCTCTTGAACCCGAGGATGGTGCCCCGGACGTAGAGCCTGACGCGCTGCCCAGTGCGTCCCTTCACCATGGCTG
CCGCTGCCGCTGCCGCTGCTTCCTTCCGCCGCCGGAGACGAGGAGCTCGGGGGTTGGTTG
page-top