Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9768  (registered. 2012)
Contig Information
Length 1173 bp
Clones alternative view 92 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_SH - 1
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 8
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 14
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195611406|gb|ACG27533.1|| cation transport protein chaC [Zea mays]
Score 382
Evalue 3.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9768
TTTTTTTTTTGCTGAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACTTCAAGTCTCAGGCTTTCGCATTAGCACTCTGGAA
GCTACAGCCTTTGCCACAATAGTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTGAAGTAAACCGCAGATCTTTCAATGGGAGAATGTC
AAAGAGTATGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCTGATCCATCCGTGCTGCTCTTCTTACTATGTTGAAACCGCAACGGTGCCCTCAGGAAGA
GCAGAGATGTGCACAACAGGTGTATGCGATTTTAATGGTATGTCGGAGCCGGTGACCTTCTTCTCTGTCGACCTGCTCAGCACCTTCCTCACCTCATCCG
CAAGCACAATGATCGAGTCATCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAACAGGTAGTCCCTATTATATCCATTAGGGCCACTGGCTGT
AGCAATCTGCTTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAGTATTTGTTGCCAACTGGATCAGGAGTGGATACGAAAACTAATACATCCGTCACA
GCTGGTTCCAGAGAATTTCCATCCCTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTCTTCTCTCCAAGTACTGCATTGCTTCTCGCTCTT
TTTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTTCATCTTCGGATTCAAGGGTGCAGGTCCTGGCTGGATGCTGTGGTGTGCCTCT
ATGGTCAATGCAAGCGAGATTAAACGTTCGCTTGTAGCCCTTGATGAATCCCAGGATCTTCTCGTCGAAGTCGAATCCGGGTTTCCAGATCAGGGACCCA
TACCCGAAGACCCACAGCACCATCTTGCTGCTGTTTTTTTAACTGGCCTGACGAGGGGCGCCGGAGAGAATGCCGCGGGTGGGGTCGGCGGCGCGGGAGG
AGGATTTGACTCCTCTTGCCTCACGCGCGTCTCCTCCGCCGGCGGTCTTCTCCCCGGGACGGACGGATGGATACCTCGTGCCGAATTCGGCACGAGGCTT
CACTGAGCTCCTGAGTGGAGAGAAGGAAGGCCTTCTTCAGTTGCCGACCGACAAGACCCTCCTGACCGACCCG
page-top