Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2493  (registered. 2007)
Contig Information
Length 1065 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to nephrin [Strongylocentrotus purpuratus]
Score 83
Evalue 3.78079
Total Hit Count 2
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2493
CGTGAGCGAACCCTCGGGAAAGGGCGAGAGAGAGAGCAGTCGCGGTCTCGACGACGTGTCGGTCGCTCCACTCAAAGCGGCGAGGGGTTGTCTCGTCCCT
CATGCCGTGACATGAACCATCAGATCTTGAAATCGACGGCTCGGATGCAAGTCAAAGCCATCTGTTGTGTAGCCAGCAGCCAGCACTAACCGAAAAAAAT
GCGTCTCCGCGGTCACGATTTCCGGGGAGGCGTCTCACATGCGTTTTGGGACTGGCATTTTTGAGATAAGATCAGGAAATGTTGGTGGTAGTATAGAAAT
AGGCTTTCGTTTCTTTAGATTAGATTCCTTCGGGACGACGCAACCTGGGAATCGGGAATTAATATTTCCGTTGACGACGCGGTACTACTACCAAAGAACG
GCTATCCTCTGACCCAAGATTATCAACCAGCTTTATTGCAGTACTAATTACGTAGATGCTCACGCACTAACTGTTTATACTCTCACGAAGAACGGCTCTC
CTCTCACCGGAGATTCTTGATCAGCTTGATTACAGTACTAATTATGTTGATGCTCGCGCACTAACTGTCAGTATATACTAGTGTCAGAAACGTTCTTATA
TTATGGGATGGATGCATGCATGGTTGAGCATTTCGAATTCGCATAATGTTTCATTATGCCGGCCATAGGCATATACCTGTTGCAAATGCTGTCAGTATAT
TATGCAGCTACTTTATCCTGCCTTGGATGTTGTGTCTCATGATTCCCTCGTGATATTTTGTTTGCGACAGCCTGGCCGCCCCTTTGCTGCTGCTGTCTCC
TGGACGCCTGCTTCTGAGGAGGGAGGGAGGGAGGAAGACGACGATCAACTTCGTGCAACTGGGACTGAGCTATCCTTCTCTGACGGAGAAATGCTGCTAG
TAGCTTAATTATTATTTCTCGTCGGGCATTATCGCCTCCTTTGTTTGATCCATGTTTATGAACCTCTCTGCATTGCAACTATTCGCTTGGTTGTCGACTG
ATGATTATGTTATGCCTGGTGCCTTCCGTGTGTATACTGTGTCGGTTTATCCGTCTCTGGTGGTG
page-top