Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9749  (registered. 2012)
Contig Information
Length 1278 bp
Clones alternative view 93 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XA Root 3
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 13
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3688398|emb|CAA06996.1|| ascorbate peroxidase [Hordeum vulgare subsp. vulgare]
Score 416
Evalue 2.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9749
TAGCTCCTTGTTACATACCAGATAGCATCCTTCCAAGAAAACAGAAAACATACAAGGTAGCATCATCCATATTTTGGCAAACAATCACTCCAACCCATGC
AACCAAGACAAGATAGTAGAAAGCAGCAATGAAGAACCTAGCTTACCCCAGGGCAGCCATCAGACCTTCGGATAGGCAGGCACACGCAACGCCCAGGTGT
ATCAGTGTGGTCTGTACATCGAGATTGCGTCGCCTCCTTTCCCATCCTCGTTCTTCTTCCCATTTTTCATTTTCTGGTACTCTGTATCCTGGCACTAGTC
TCAGTCGGTGGTCATGGGCTCGGAGATGCAGCAGCGGAACCGTGCCTCGTGCCGAATTCGGCACGAGTCACTGCTGCATTTCATACGATAGATCCGAATG
CAACGGCACACCAAACCACTGACAGCGTACAAGGTATGGCCTTAAGCCAACGGACATTATTACAGAGATGATTACTTAAAAGTCTGCTGGTTCACACTGA
CCCCTAGTCTAGAAGCAGAACAAGATCACCCTGGTCACACATAGTAGCAGCAGTAGTAGACACCTCTTACGCTTCGGCGTACCCCAGTTCGGAGAGCCTG
AGGTGTGCCTCCTTGTAGTCCTCAAAGAAAGCCTTCTCATCCGCAGCATATTTCTCCACAAGAGGGCGGAAGACAGGGTCAGTCAGCAGGGTTTTGTCAC
TTGGAAGCTGAAGAAGTCCCTCTTTATCACCACTCAGAAGCTCCGTGAAGTAAGAGTTGTCAAACTTCAAAGGGTTCCTTGTCCAGGGTCCCTCAAAGCC
AGACCTCTCCTTGTGGCACCTTCCCAGGGTGTGGCCACCAGAGAGGGCAACAATATCCTGATCACTCAAGCCCATCTGCTTGCCAAAGACTTGCCTTAGG
TGGTCAGAACCCTTGGTAGCATCAGGGAGGCGACCCTCAGGTGGGGGCTGAGGCTTGTCCTCCCTCCCTGGGTGGAAGGGGATCACGGGCCCACCGGAGA
CCTCCACGGCGACAACTCCCGCAAGCTGGTAGAGATCGGCGTAGGAGATGGTGGGGATCTCCTCCTTCATGGGCTCGAGCATCCGCACGGCGATGTCCAG
GCCCGCGTTGGCGGCGTGCGCCTGCTCCGCCGGCTTCTTCATCGTCCCGAACGGGCCGCCTGTCTTGGACGACACGTCGCTTCTGCCTGGCCTTCTCGAC
GGCCTCCTGGTACTCGGCGCTGACGACGGAGTAGGTCTTCGCCATGGCTGCCGCGGCTGAGACTCCGATCAGGCGGGG
page-top