Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9740  (registered. 2012)
Contig Information
Length 1258 bp
Clones alternative view 104 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 1
Wh_SHDr Shoot grown with dessication 10
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 21
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 13
WH_XT Roots, 18 day old plants were grown hydroponically 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 2
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|19880505|gb|AAM00368.1|AF366564_1|AF366564_1 aquaporin PIP1 [Triticum aestivum]
Score 593
Evalue 2.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9740
CATCATCTCCTCCACCTCTCAACCAAGCCAAGGCCAAGAGCCCAGTGAAGCAGCGGCCATGGAGGGCAAGGAGGAGGACGTGCGGCTGGGCGCGAACCGC
TACTCGGAGCACCAGCCCATCGGCACGGCGGCGCAGGGCGGCGGCGCGGACGAGAAGGACTACAAGGAGCCGCCCCCGGCCCCCTTCTTCGAGGCCGGGG
AGCTCACCTCCTGGTCCTTCTACCGGGCGGGGATCGCCGAGTTCCTGGCCACCTTCCTCTTCCTCTACATCTCGGTGCTCACCGTGATGGGCGTGGTGGG
CAACCCGTCCGGGTCCAAGTGCGGCACGGTCGGCATCCAGGGCATCGCCTGGAGCTTCGGCGGCATGATCTTCGTGCTCGTCTACTGCACCGCCGGCATC
TCCGGCGGCCACATCAACCCCGCGGTCACCTTCGGGCTGTTCCTGGCCAGGAAGCTGTCGCTCACCAGGGCCGTGTTCTACATCGTGATGCAGTGCCTGG
GCGCCATATGCGGCGCCGGCGTGGTGAAGGGGTTCCAGACCACGCTGTACCAGGGCAACGGCGGCGGCGCCAACTCCGTCGCGCCCGGGTACACCAAGGG
GGACGGGCTCGGCGCCGAGATCGTCGGCACGTTCGTGCTGGTGTACACCGTCTTCTCCGCCACCGACGCCAAGCGCAGCGCCAGAGACTCTCACGTCCCC
ATCCTGGCGCCGCTTCCGATCGGGTTCGCGGTGTTCCTGGTGCACCTGGCGACGATCCCCATCACGGGGACCGGCATCAACCCGGCGAGGTCCCTCGGCG
CCGCCATCATCTACAACAAGAAGCAGGCGTGGGACGACCACTGGATCTTCTGGGTGGGCCCGTTCATCGGCGCGGCGCTGGCGGCCATCTACCACGTGGT
GGTGATCCGGGCCATCCCCTTCAAGAGCCGCGACTAGTCCACCAATCAACCAGCCGCGAATGGAATCTTATCGCTGTTCATCGTCGGTCGATCGATCATG
TGGTGGTGGTGGTGGTTGCTCGCGCGCGCGTAGTACGTGGATCATGTCTCGGCCGCGCACGCTGTAATCATCTATATCTACCGTGCTGTTCCTCCCCTCC
TCGGTGTGTGTGCCTGTCGGCAGCGTCACCTGTTCAAGTCTGCGAGTTGTACTTTCCCTTCCTTTTGTATTGCACTACGCACGCGATTTAATCGGGCGTG
CATATCTATGTAAATTATTACGTATTATGAAGGAAGGACGATCGAGTTAAAAAAAAAA
page-top