Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9739  (registered. 2012)
Contig Information
Length 627 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_VSCB Liquid cultured tissue 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226505392|ref|NP_001152085.1|| LOC100285722 [Zea mays]
Score 211
Evalue 3.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9739
TTTTTTTTTTGGTCATAGTTTAACTCATATTAACTAGCAGTAAGCTTCACAAGAGATAATCCATTCCAATGACAGCCATCAAGTCAACTCATGTTTACAG
CTAACAACAGCAATACATCATCATCATACATAGAGAAAATCGGTTCGCACAAACCGACAAACTAAACTAGAGGCACATCATAAGAAGCTCACAAGCATGG
CTGCCGCAGCAGTTTGTTTCGCCAGTAAAGAAGACAGCAGCGACTTCCTTCCTTCCTCGACCAGGCAGCGGCTCACCTCACATCATCTACCTCCTCACCG
GAGGCGCGCCACCTCGTCCTCCTCCAACAGGGGGGCCACCACCACGACCACCAGCAGCCCGGGCACGCATCGCGACAGCACGGCCACGCCCGACGCCGAT
GGCCGACCCCTTGCCCCTTATCCTGGCCTCGAGGCGCTTGAACATGGGTGCGTTCTTGAGCATGTCGGGGATGATCATGAACCTGACCCTGCTGCCCCTG
ATGAAGACGTGCTCCAGCTGCGACACCTTGCCGTCCTTGGCGGTGAAGGTGATGTTCTCGATCTGGCAGTTCCAGTTGTCCTCGCACTCGATCATGGAGC
CCCGGTAGACCTCGCCGGTCTTGAGCT
page-top