Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9734  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_CSEC Callus 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224551496|gb|ACN54190.1|| ubiquitin-like protein [Triticum aestivum]
Score 402
Evalue 2.00E-110
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9734
TTTTTTTTTTGCGGTAACACCGGATCATCTGATATGTATGTACATCAATCCAAATTGTCAATACAACACAGAAAAAACAAAGGCATGACGACCATGTACG
GGAAAAAGTTAACTGTATTATTCCGTCTTTTTTACTGTAGACGGACACTGCCTGTTGGCTAAAACAGGGAGATTACGGGCAGCATCTGGCTCGTTTTATC
TACTGGCCAAAGTTCCCGAGAAGGCGCTCCACAGCAGCATGTACGTTCCCAGAAGTGGCCATCAGTGCCCGAATATTCTCTGCGGTGTCAAAGAACCCCA
TTTCTTGGAGCTGGCCAAGTTGCGTTGCATAGAGTTCCTCCGGTGGCACATTGGAGGCATTTGGTACACCTAAGCCACCTCCAGCACCAAGCCCACTAAG
CATGCCCATCAAGGTGTCCAGACCAACATTTCCCCGCGTGCCTGTGCCATTGCCTCCTAGGTTACCAGCCTGGCTAGGTTGATTTTGGCCAAGCTGTGAT
GACATTGTCTGCTGTAATGAGAGTAATTGCTGCAAAGCCTCTGGGGATGCCATCTGGCGAAGAAATTCTGGGTTTTGGAACATATCCCTCAACTGAGTGT
TTGACTCCATCAGGCTGCGTGCATTTGGGTTCATGCTAAGCAACTGGTTCATTGACTGTGGGTCAGACATAATGTTCTGCATCATCTGCATCATAGCAGG
GTTTTGCAGCATCTGACTCAAAAGAGCAGCATCAGGTGGACCACCAAGCATACTCCCCAAATCTGCTGAACCCAACCCTCCTAGACCACCTGCAGCACCA
GTTCTTGCATTCCCACC
page-top