Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9729  (registered. 2012)
Contig Information
Length 897 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 1
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_CA 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115460222|ref|NP_001053711.1|| Os04g0591100 [Oryza sativa (japonica cultivar-group)]
Score 180
Evalue 2.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9729
TTTTTTTTTTCAAGCAAAAACAAGCACAGTGACATTGAAGAAGGCCGTCAGGAGCAGCAAGCATTCTGAAGGTTATTACAGGACGACGAATATCAACACC
AGTCTCGCTACCATTCCCCATCTGTGATAGTATACATATATGTACATCTACCATATCAAACACACCTAAGAACAACCAACGCCTATAAGGAAAGAAACTT
GCAAAACTTAGTAGCTAGCTACCACATCACGGAGTAAAAACTTCTACTACGACCACTACCTCCCGCCGTTCCGGGGAGACGAACACACCCAAACCCTTCC
TTCCTGTTACCAGCACAGTAACTGTTTGTAGTAACTATGATGAAGTAGTGGTGACTATCCCGCATTGCCCTGCACCGGCCTCCTCGTCCAGAAGCGCAGA
GGTGCGGCAATGGCGGCTCGTTATTTTTTGCTTAAGCTCCTTCCTTCTCCTTGGTGTATAGAACAGAACGGAACGGAAAAACTCTAGAGGTAGATATGGA
TGGATGGATGTGTATGCTACAGTGGTACCGGCGAGGGAGGCGGGCGGGCGCGCGTTGCTCTGCTTTGCTCTTGCTCAGAACTCCACAATGAGGTTGCCGA
AGGGCGACCGGTGCGGGATGCCCTTGCGCCGCTTGGAGGAGCGGTAGCTGTTGGCGGTGGCCGGCGGGGTGGACGGGGAGAAGCTCTGCACCACGCTGCT
CTTGTCGCTCCCGCCGCTGGTGATGGTGGACGAGTCGTCCGAGTCCGACGCCGCCGCCTTCTTCAGCTTCAGCTTCATCTTCTTGCCGCCGGCGTGCCTC
TTCCGGCCGCGGAACTCGCCGGAGGTCCCAACGATCTTGCATCCGAGGGAGCAGAAGCGGAAGGTGTCGAGGAGGCTGCGCTCGCAGACGTCGCAGG
page-top