Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9717  (registered. 2012)
Contig Information
Length 1421 bp
Clones alternative view 39 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VHS Shoot with heat shock treatment 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 6
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115465579|ref|NP_001056389.1|| Os05g0574400 [Oryza sativa (japonica cultivar-group)]
Score 592
Evalue 4.00E-167
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9717
TTTTTTTTTTCCAAACAAGCACACATTTTTTTTTTCAGTTCAATTCAACAGATAACAAACGGTGTCGACAATTCAACAGAGGAATGGCAAACCCACCCCT
GTATGTGGAGCACAAGGGGTCGATCCGCACGAATATAATGCCCACAGAATCCTCAGTTTCGCTTCTGATCTCGGGTACGAATGCTATAAGCACATAGGCA
CCGGTGTCTGCTGTTTCTGGTACTACAGGTTCAGTTCAGTCTGGCGAGACATCAAAGCCAGTACATTTTATTGCGGAGCACGACGACGCCTCGATGCCCC
GCAGCACAACCGGGTTTGGAGGCAACGAAAGCGGCCGAACAAAAATTGCATGAGTTCAAGTGTGAACCGTTCGATATAGGCTGAGCAGGTCGCCGCCTAG
CTCTCCTGCGCGAACTTGACCCCCTTCTCGATGGAAGACAGCAGCTCGCCCTTGAGGCTCTCCAGCCCCTCCTTCTCCAAGGCCGACAGCTCGCCCAGCC
CCATCACTTCCTCCACTCCACTCTTGCCCAGCCTCACCTTGGAGGCAAAGAATGGCAGCTCTGTTACGGTTGATTGGACAAAAGAGCACTCTACAATGTC
AGGAACACCGTTGAGCCCCTTCAAGCATGCATCTCCAAAAACTGCACCAGCATATGCCATCGACAATGTTGCTGAGCCCTTTCCAGCCTTCGCTTCAACA
ACTTCCGTCCCACCATCTTGTGTCCTCTTCGTGAGGGCGACAAGGTCCTCATGGGACAATGCATTACTTGCAGGAGTAGCCTGCGAGAACAGTGGCAGGA
TAGTGATTCCAGCATGGCCACCAACAACAGGAACATTCACCCCAGTAACTGGCACGTTCGCCTTTCCAGCATAGAATGTTTTAGCACGAACAACATCAAG
AGTGGTCACACCAAACAGCTTCTTCTCATCATAGGTACCAGCCTTCTTGAACACCTCAGCTGCAATTGGGACAGTCGAGTTGACAGGGTTGCTGATCATA
TTGACGAGAGCGTTGGGGCAGTGCCTGGCGATGGCGGTGCAGAGGCCCTTGACGATCCCGGCGTTGATCTTGAAGAGGTCGTCCCTGGTCATGCCGGGCT
TGCGGGGCACCCCGGCGGGGATGATGACGAGGTCGGCGCCCTCCAGCGCCTCCCCGAGCTGGTCGTCCCCGACGAAGCCCTTCACCAAGGCGCGGGTGTT
GATGTGGGAGACGTCGGCGGCGACGCCGGGCGTGGCGGCGATGTCGTAGAGGGAGAGGGAGGAGACGAGCGGGTTGAGCTTCATGAGCAGCGCCAGCGGC
TGGCCGATGCCGCCCGCCGCGCCGAGGATGGCCACCTTCCGCTCCGGCGAGGCGGCGGCGGAGGAGTAGTCGCGGCGGCGGCGCAGGTGCTGCGACGCGG
ATCTCAGCAGCGACATCCTCA
page-top