Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9712  (registered. 2012)
Contig Information
Length 637 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 5
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XA Root 3
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242049264|ref|XP_002462376.1|| hypothetical protein SORBIDRAFT_02g024610 [Sorghum bicolor]
Score 234
Evalue 7.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9712
ACACAAGTAGATTCAACATGCATTCAGAAATGAAACTGCAAATGGGTATCAAATGTTTCACAATCTCTGATGTCACGGCGGCAGAAGGATTTCAAGTACT
CTAAAACATTTAGCTAGAAGGGACTAAACCATTGATCATAACCACCAACAAAAATATTTTCCTTGTTTACAGAACACCATCTCACTTCGCACTTCCGTTT
CAAACAGATTACTTTGAGGTCGTCTTGTCCTTGGTCTTCTGTATTTTCAACACCTTCTTCACGATCTTCTGCTCCTCAACCAAGAAAGCGCGGATGATCC
TTTCCCTCACCGCAGTTCCAGAGAGCACTCCACCATAGGGACGGTTCACAGTCCTGCGGTTCCTAGACAACCTTGATCTTTTGTATTCAGTAGGCCTGAG
GTGGGGAATCCCCTGGATCTTCTTCCCGGTCACAGGGCACTTGGGGCCGCTCGCCCTCTTCTTGGTGTACTGGTACACGAGCTTACCACCTGGGGTCTTG
ACGACCCGCGTCTGGTTGGACTTGGTGGCATAGCTGTGCCTCTTCCGGTAGGTCAGACGCTGCACCATGTTTCCGTCGTCTCCGCCGCCGGCAGTAGGGG
GCTTGCGCAAAGAGTGGGGAGAGAGAGAGGAGAGCGA
page-top