Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1679  (registered. 2007)
Contig Information
Length 1111 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pyruvate kinase [Capsicum annuum]
Score 211
Evalue 5.83302e-15
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1679
AAAATAGAACTATTCTTTACAACTTTCTGAAAAGCTAAATATAATTCAAAAATAATTATGAAGAGAGGTTAGTAAATAAAAATACAAGTCATGACTAAAA
TATTAAAGTGAGAAAAATATTATTTTTTACCTCATAACAGATACTGTGGCATACTATCTTCCAATATTCCTTATTTAGTGCCAATGTAAATTCCATACAT
TAAATGTCTAGATCATCTGAAATGGCCATGAAATTACAAAGTGGGAAGGTGGAACAACATTTACACAAGTATAGCATGCAAAATCAGCATCTTATGTGTA
TAGTCTATAGCTTCATCAGGGCAAGTAAAAAAAAATCAGTCCGGCCTATAAATTGTACATAAAAAACTGCAGTTAAACCAATGGACAATTGGAATGGATG
TTGCCTACAATCGCTGTGACAACAGGCTCACCAGCAAGGTTGCACTTGTAGATCATCATTTTCTGTGCAAGGGATATCTTCTCAACTGAAATCTCCATTC
CAAAATCACCTCTGGCCATGAAGTAATTGGTTTCCCACAAAGTGTCATCAAAGTTTACAATGCCCTCTTGGTTTCAACCTACCAATTCAAGAAAGAATAA
CAACATAGCCGACATGGTCACGGGCAAGCACGTATGTTTATAGGCACAGTAGATTTAGTCAACACAGCAGTTGAACGAAGCTAAGTAATCTGAACAATTT
TACAAGTACCAAGAAATAAAACTTACCACAGGAGATGCAAGAAATAAAATTAGGCAAAACTTGTTCAACAAATTATGCTAAGGCTTTTGTGAACCAAGTG
TATTCATTAAGGAAAGCACATAGAAGAGAACCAATTATGTATTTTTTGACTATATAACACATAATAGACTATAATGTTTTTTTACAAACAGGAGTAGATG
TGAAACATGTCCTCGGAGAGACAAAGAGTTCATGGGTTCCAGAATCAAGTGTGTATATTAACAAAAAGTTGGACGTTATAACAGTAAGTTGTCGAGTGTG
TATATTAACAAAAAGTTGGACGACATAACAGTAAGGCAACTCAATGAAAGGAAGGAACATCATCTGTGGTTGCCCCTGGTACTTAACTGACGTGCAAAAA
CATTTCATCAG
page-top