Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1675  (registered. 2007)
Contig Information
Length 967 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07409 [Oryza sativa Indica Group]
Score 677
Evalue 4.31332e-69
Total Hit Count 41
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1675
TGCCACCCCCCACCACCTTGGTTTTTCACCGGGAGAAAATAAGGGTTAAAACTAGGTTCCATCTGGTCCATCACTGCACAGTTACAACACAGGGTACATA
CATGGACAATCTGTCATGGATATAGCCATCAGGCGGGTATTATACACCCACATGAAGGAGAATGCTGGTTCTATTAAATTAACCTCCACCCTAGTCACAG
CCTCAGGAACGCTAACTTCGACACGGAGCCAACGGAACTTCTCCAAGCTCACACATCTTGCGAAACAGGAAGCATGTCTATCCCAATTCTGCAATCACCA
TCTGAAAGACAAGCAGCACATATAGTTTTAACCGGGAACAGGTTCGGAAGTAGTAGAATGCCCGCCGCTAGCGCCCGAGTGGTTGTAGCCGATCACAGGC
ATGGATTTCCGAGCAAAGTCAAGAAGCATCTGGCGTTGTTCTTCGCTGGTGTGCGGAAGGCTTGCACGCAGTAGCTCGACGGGCATCTCCCTGCTGACGG
CCTTCGAGGCTTCAGGTCCAGCCATTGAGTTGGATCCCTGCATGCTGAACCTCTGCAGAATGCTCCCATACTTGCTGTCGCAGTATTTTGTCAGAAGCCC
AAAGAAGGCATCGAATGACGCCTGCCAAAGCGAACGGGTTGACCTGCTGTAGTTGGCTGCAGAATGGGGATCGGCCAGTAGCTCAGTTGCTCTGTCCAGT
ACTGATTTGATGATTAGAGCAGCACCATCACCAGCAGAGCTGCCAAGAGGGCGGAGAGGTGGCTGCTGCGACGAGCAGACAACAGCTGCGAGGCAGGCGC
TGAGGGCACTGAGCTCCATGTGATGCACGCAGGAGGACACGGTCTTGGCAAGACTAACTGTTGTTTCTGCAGCACCAGAATCTGATGGCAAACCCCCAAA
CAAGCTCCTAAGATGCCGAAAGATAGCCATGCAAACTATGCGGGGTTAGCTCACTTCCAGGGGCAAG
page-top