Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig968  (registered. 2012)
Contig Information
Length 1065 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 2
Wh_OKCS Seed DPA5 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115589734|gb|ABJ15726.1|| 5,10-methylene-tetrahydrofolate"
Score 559
Evalue 2.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig968
GTCGTAGCTGCAAGTAGAGAAGGAGAGAGAGGGGAGAGAATCTAGTGCTACCCCAATGGCGCAAATCATCGACGGCAAGGCCATCGCCGCCGAAATCAGG
CACGAGATCGGCGCCGAGGTCGCCGCGCTCTCGTCCGCCCACAACATCGTGCCGGGGCTGGCGGTGGTGATCGTGGGGAGCAGGAAGGACTCGCAGACAT
ACGTGCAGATGAAGCGCAAGGCCTGCGCCGAGGTCGGCATCCGCTCCTTCGACGTCGACCTCCCCGAGGACATCTCCGAGGCCGCGCTCGTCGCCGAGGT
CCACCGCCTCAACGCCGACCCCGCCGTCCACGGAATTCTTGTTCAGCTTCCATTGCCCAAGCATATCAACGAAGAAAATATCTTGAACCAGATCTCCATT
GAGAAAGATGTCGACGGCTTTCATCCTTTGAACATTGGCAAGCTCGCAATGAAAGGCAGAGATCCACTGTTTGTACCTTGCACGCCAAAGGGATGCATGG
AGCTCCTGTCACGAAGTGGCGTCACTGTAAAAGGAAAACACGCAGTTGTGGTTGGGCGTAGCAACATTGTGGGTTTACCAGTATCCCTTCTCCTTCTGAA
AGCGGACGCAACCGTGTCGATCGTGCATTCACGGACCCCAAATCCCGAAACAATTGTCCGTCAAGCAGACATTGTCATTGCAGCAGCTGGCCAGGCCATG
ATGATCAAGGGAGACTGGATCAAACCAGGCGCGGCGGTCATCGACGTCGGGACAAACTCCATCGACGACCCAACCAGGAAGTCTGGGTACAGACTCGTTG
GCGATGTGGATTTCTCGGAGGCGAGCAAGGTCGCGGGTCACCTGACTCCGGTCCCCGGAGGCGTCGGGCCGATGACCGTGGCGATGTTGCTGAAGAACAC
GGTGGACGGCGCCAAGAGGGGTATAGTCAGCTGATTTGCTGCGTGATTTGGTAATGTGGGGATGATGTTGTAACTGGGTGCCTAGACTAAAATCGGTTCC
CCATTTTGTCATGGCTTACGCTATTTCGAGATCAATAAACGACGCTCAGTAGCTCAAAAAAAAAA
page-top