Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9671  (registered. 2012)
Contig Information
Length 1128 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242048234|ref|XP_002461863.1|| hypothetical protein SORBIDRAFT_02g009510 [Sorghum bicolor]
Score 437
Evalue 1.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9671
TTTTTTTTTTAAGTACAGCAATTCAACCTGCAATGTTTCATTGGCTCAAAATAATCACTAAACCGCTGAAAAACTGAAACCCCAAATAAAATGCTGCGGC
ATACTCTGTCACTTCACCGCAATTCCTATACATGAACACAGGTTATACAAAAATACATGTTCGGACCACAGACTATCATTCGTCCTTGCTGTATGGTGCC
CCAACATCAAATTTATTACACTGCATCTTGTTTATATCTAAGCATGCTTGAAATGTTGTATACTAGACCTACTAGTATCACTATATTTATTGATCATGAC
ACTGTAGCTGATTGACCCTCAAAACTTATCTATAGTCTTGATTGTGTTCCTCCAGCAACAACAATTGTTTCAGCTGTAATGAAGGATGAATCGTCGGATG
CCAGGAAAGCGGCAGCTGAAGCCATGTCTTCCACGCTACCCAATCTCTTAAGTATGCTCCTCTCGATAAGTTCATTTCTGATGGTCTCATTAGTTGTGAG
GAAACCAGCAAAGCGTGTAGGAACAAACCCAGGAGCTATACAGTTAACACGGGTATTTGGGCCCATCTCAGTAGCAAGAGCCTTCGTGAGACCAAAAAGG
GCAGTCTTTGTAACACCATACATCGTTAAAGCTGCATCAGGATTATAGCCAGCAATTGAAGAAATTAGTATCACAGATGATCCCTTCCTCAAATGTGGTG
CGGCGTCCTGAAGTAGAAGAATAGAAGCTTTGACATTAATATCCCATAGCTTGTCAAGAACTGACTCTTTCATCTCTAGTATGCTATCCACAGAAGGATT
TGCAGCGGCATTGGAGACAACAATATCAATATGTCCGAAATTCTTGACGGCCGTGTCGATGAGGTGCTTGCGCTGCTCGGCGTTGGAGACGTGGCAGACG
GCCCCGACCACGGTGATCCCCTTTGCTCTGAGGCCCTCCACCGCCTCGTCCACGTTTTTCTGCTTGCGGGAGGAGATGACGACCGCGGCGCCCTCCAGGC
CGAGGCGCTCGGCGATGGCGAGGCCGATGCCCTGCGTGGAAGCCGTCACGACGGCCACCTTCCCCTCCAGACGCCGGCACTTGACATCCATCGCCGGCCT
CGCCGTGTTTCCTTTGCTACGCACCGCT
page-top