Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9658  (registered. 2012)
Contig Information
Length 925 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_SP 9
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|24496452|gb|AAN59956.1|| actin [Hordeum vulgare]
Score 345
Evalue 3.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9658
TTTTTTTTTTAAAAAAATCCATAATTTACCATGATTCTTCCCTTAAGAGCAATAATAATAAGATAAAAAAATACATAGCAAAAACCATGAGCTATTACAG
ACAACTCCAACAACAAATCAAGCCAACCCAAGTTTGACAACTGATCTCACAAACACACTGACAATACACAAACATAGATATAGTGTACTTGCACTTGCAC
CATGGAGCCGCCACGTATATAGGTGGCATATCCCAAGAGTACTCACGTCACGTCTGGAAAAAAACATAGCTTGCAAATACGCAATACATTTCTAGAAGAA
TGAACCAAACATAACCCGAGACTAGATGATAACGGCGGCGGAGTGCTCCCGGAGATCAGAAGCACTTCCTGTGGACGATAGCCGGGCCAGACTCGTCGTA
CTCATCCTTGGATATCCACATCTGTTGGAAAGTGCTGAGTGAGGCTAGGATGGACCCTCCGATCCAGACACTGTACTTCCTCTCAGGTGGGGCGACAACC
TTGATCTTCATGCTGCTCGGAGCAAGCGCGGTGATCTCCTTGCTCATACGGTCAGCGATACCTGGGAACATAGTTGTGCCACCACTGAGCACAATGTTGC
CGTACAGGTCCTTCCTGATATCCACGTCACACTTCATGATGGAGTTGTAGGTCGTCTCATGGATTCCAGAAGACTCCATGCCGATCATGGATGGCTGGAA
GAGGACCTCAGGGCACCTGAACCTCTCTGCGCCAATCGTGATGACCTGACCATCAGGAAGCTCGTAGCTCTTCTCAACTGAGGAGCTGTTCTTGGCAGTC
TCCAGCTCCTGTTCATAATCAAGGGCAACATACGCAAGCTTCTCCTTGATGTCCCTTACAATTTCCCGCTCGGCTGAGGNNNNNAGGAGTAACCTCTCTC
GGTGAGGATCTTCATGAGGGAGTCC
page-top