Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1403  (registered. 2007)
Contig Information
Length 1200 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_001621 [Oryza sativa (japonica cultivar-group)]
Score 211
Evalue 6.49963e-15
Total Hit Count 48
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1403
CTGGGAACAGTATGTCAAGTCTTGAGAATTGGGATGGATTCATAGATGTGGATTGCCCACGGGCGAGGATGTGCGCCGCAATAGCTCTAAGATGCACGGA
CGCTGAGGAATATAATAGGCCTACCTTACATGAAATAATTTGTGAACTGAACAAGGTGGAGAGCATGGTTTCACAGTTTCCCATAAACCAGCTGCTGCAC
CCTGTCGGCACTAGTTTTGCAGTACTGGTAGCTTATGCATTGTTGCTTATGATCAGTACAAACTACATCCAAATAGCTGTGATCCCGGCTATCATACTCG
TTTTCATCGGTGTTTTGTGGGGCAATTTCTGGGTCAAGGGAAGACTTCAGCATAGAAACAACAATGGAACTGCTGCTAACCAGGGGAGTGGCAGCGGGCA
AGCTTGGAGGATGCTGCTACCCACGGTACTACTGTCGTATTGTTTGCAGCTAATCCAGCTTGCCTGTGCACAAGTGACCAATGGACAACAAAGTGACAAT
TTCCTCTTCTCTCACTCCCTCCTCTTCCTGAGTTCCGCGCTTGGTGCACTGGCCGTGATGATTGCCGCGCTGCCCATCAGAGCCAATCAATGTGTGGCGC
AGGGACAGCAGCTTATTCACAGGATCTTCATTGTGGTTTTTATGATAGCAGTGCACATGATGGCTACAGAATGGATGATGGTGGAGGTCATGCCACTGGT
TTGCATGCCGGAGTTTATTGCATCACTTGTGTGGCTCACCACTGGTAATTTTGATCACGCCAGATGTATGGTGCTCATCGACAAGGTAACATCACGCAGA
TCAACAGTCACCTTTCTCACTGCAGCAGTGGCTCTGTTAGCGTTCATGTTTGCATTTGAGAACGAGATGGTACTTGCTAGTTACTGGTACAGAGGAATCA
TGTACTCCTGTACCTTGTCAGGGCTTCTATCCTGCTTGTGCGTGTGGATGATCCTTCAGTGGCGGCCGGATATCTCTGCTAATGTGCCCCTTGACTGGCC
GAGCGGTAGTGCGATCATTTCCATAAGGATCCTTGAGTTCTCGGCACTGATTTGCTTTGCTATGTCAGCTGTGCTTCTCTTCATTGGGTTCCTCTTGAAT
TACTCAATTCTGTAGATCTAAGTTTGCTATGTAAGCATGCATGGCTACCTTGTATGGCGGCCTCGGGACAAAGATTGACCATAACTGTAGTGTTTTGCAA
page-top