Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9653  (registered. 2012)
Contig Information
Length 778 bp
Clones alternative view 100 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_r Root 4
Wh_yd Spikelet at late flowering 5
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 8
WH_XA Root 8
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 14
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|76573307|gb|ABA46758.1|| unknown [Solanum tuberosum]
Score 261
Evalue 6.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9653
TGAGCCGGGCAGAATACTAGATTTAAACCTCTTTATTTTTTATCTCGACGGAACAACATAATATTGCATATGGATTTTTCAGAATTAACGACAGGCACAG
CTCATAGTTTTCAAACAAAGGCACCCAATCCGAAAGTGCATAACGGATTCCAGAATAACTCAACAAGCAGCGGCAGCTAGTCAGACAAAAAAAGACAACT
TAGGTGTTCCTTGGGAAATATCCTACTAACACATCTCAGATACTTTCATCGAATTTTCCATTTTCCATTTTCAGTAGAAAAAGCCTAGCACCTTGCCACC
AACATTCTTACGCCTTGCCTCCTCATGGTCCATGATCCCAGCAGAGGTTGTCAGCACGATGTAACCAAACTGACGAGAAGGAAGGAGCCTTGCAGTCCAT
CCCTCAATCTCCTTGACACCAACATCAAAGCGAGGACTGATGACACCACACTTGTTCAGCCTGCCATTCAATTCAACCACGATCTTGCCAGACCTGTGAT
CATCAACATACTCAAACTCGCCAATGTATCCATGCTTCTGCATGACGATAAGGAACTTGATAATGACCTTGGAAGAAGGCCTGATCATGACCTGCCTCTT
CCCACGCTTCTCAGCGTTGTACATGCTCTTGAGAGCATCGTTCAGCACACTGACTCTCACCATCCTTACCTCTAGGGAGCGAGTCGAGCTCTGGCCGTGG
CGGCGGCGGCGGCGGCGGCGTCTGCGGAGCGAGAGCGGCAAGCAGGAAGGCGACCCTCGTGCCGAATTCGGCACGAGG
page-top