Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9650  (registered. 2012)
Contig Information
Length 676 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 6
WH_XC Root, treated at 50 microM Al for 6h 13
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473665|ref|NP_001060431.1|| Os07g0641700 [Oryza sativa (japonica cultivar-group)]
Score 167
Evalue 9.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9650
TACGCTAGAGTAAAACAGGGCACCAATGCATCAATGAACCCACTATTATAATAATCCAAATAACGCAAGGCTTAGCAGCCAGGGAAGTAATTTGACGAAA
ATTAAGGCAGCACTTCAGCTGCAAGTTTACTGAACTGCATCACGACAGAAAGTCTGGCAACAATCATATAAGTCTATCATCACACCATAAAAGAGAGTTC
TACTTCAGGTTTATCCGATAACATGGAAACTCTAACATCCTCTCCTCCTGCATTAAAGCAGCTGATGACTTCCGCACCATCCGAATCACTCGTGGAGGGT
GCCCAGAATGTCATCGTCTCTGTAGAGGAGGTACTCTTTCTCAGGAGCAAGCTTGACTTCAAGACCACCATACTCAGGCAGGAGCACATGGTCACCTTCC
TTGAGAGCAACAGGGATCAGCTTCCCTTCCTTGTCACGGCTGCCAGGGCCAACAGCTATGACCTTACCAGAGTTCAGCTGCTTGGAGGTCTCCGGGAGGA
GGATGCCGCCGGCGCTCTTCTTGGGCTGCACCACCTTCTCCACCAGCACCCGGTTGAAGGACGGGATCAGACGCCGAATCGCCGCCATCGCCGCCGCCGA
CGAGATCAGACGCCGCCGCTCTTCTCCTTCTCCTTCTTGGGAAACAAGCAAGAAAAGAGAACGAGACGCTTCCACA
page-top