Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9636  (registered. 2012)
Contig Information
Length 717 bp
Clones alternative view 70 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 7
WH_XB Root 12
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242063294|ref|XP_002452936.1|| hypothetical protein SORBIDRAFT_04g035260 [Sorghum bicolor]
Score 213
Evalue 2.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9636
ATCAAAAGGGCATACAAACATTCATAAAAGAAGAGTAAAAACATCACTGAATCAGATTTGATAGCTAAAATTGCAAGGATAGAACGCAAAAAGTGGGCAA
AACACAGCATCAGGTTCGAACTACATATAACATCATATAATATGCGACCCACACATTCAAGATAACATGAAGACTACAGTTCTTCACAGGGAAACAGCAG
TTCAACTTGCTATCCCGGCCTGAATCCATCTTACATGACTCGAAATGAAACCTAAGGGACGAGCGAAACCCTCCAGACTTCAAAATAACCTTTTAGATGC
TGCTCGGGTACATGAAGATCCTGACCTTTTTCCCCATGGCCTCGGCGGGCAGGTTGGAGGTGAACTTGGCGCGGACGACGCCGGTGTTGCCGTGGGGGCG
GGAGACCTTGCCCCAGATGCAGCGGTAGTGGGTGCCGTTGCTCTTGGTCTTGGCCTTGTAGACGTAGGCCATCCTCTTGCCGCCGTACCAGGCCACGTCC
TCCCTGGTGTTCACCCCCTCGATCTGCACCAGCGACGCTGTCTCGTACTGGTTCGACTTGGACCTCTTGTATCCGAGGATGGTGCCGCGGACGTAGAGCC
TCACGCGCTGGCCGGTGCGTCCCTTCACCATCTTGCTGCTGCGGCGGCGCCGGGGAGGGGGGCTGGGGGTTCGGGGTGAGCTGCGCAACCTGCCGAATTC
GGCACGAGGCCTCGTGC
page-top