Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1177  (registered. 2007)
Contig Information
Length 454 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32232 [Oryza sativa Indica Group]
Score 475
Evalue 2.48855e-46
Total Hit Count 44
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1177
GTTCTTCAAGAATCAGGGAAAATTCTCCAACCGCGCGACATCGTCAATATCGAGCACTGCTGTGACCGGCGAGATATCGAAGATGGCGGCCCAGGCGGTG
GGTAATTCAGTCTCCGAGTTCCAGTCGGGTTTCAGCGACATGAGGTCGGACATGGCAGCGAGGGTTTCTTTCAAGTACGGGTGCACGAGAGGGGTGGCTG
GCGCGCCGTTCTTCTTCGTGAACGGCTTCCTCCAGCCCGGAGGCGGGTCGCCCATCGACTTCAGCACGTGGACCAGCATCCTGGAGCCCCTCGTCGCGCA
TCACGGCCAGACCATCGAGATGTTCACTTCGGTGTAATGTAAGCATTGCAATCGCCTTTTATATGTTTGGAACCAAAGGATGGCTATTGTACAGACAGCA
GCCCTGTGTGTGTAAACCGGTCGACAGTAGTATTTTGTTCTTCTAAAAAAAAAA
page-top