Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9622  (registered. 2012)
Contig Information
Length 1750 bp
Clones alternative view 70 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_oh Pistil at heading date 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 7
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 13
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212007829|gb|ACJ22514.1|| cell division AAA ATPase family protein [Triticum aestivum]
Score 559
Evalue 4.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9622
TTTTTTTTTTCTCAAATAGAAACCACGCACTAAAGATAGTGCCAAAAACTCAGAATGCAATGTACTACCATGTCACTCCAATTGCAAATAGTGTCAAAAA
TTCATAGTTTGACTCTGAACTTGAAGTGCAATGTACTACATTCGTCTCCAATTGCCACAGGCTACAAACTTGGCATAATGTGGAAATACAGGGCAAAGCA
TTGAGATAAATCAACATGCAAAATCTATTTCTTCTTGTCCGTAGCACCACCACCACCAGACCTCATCTTCCTGAGGACACTTGACATCTCCTCCCTCTTC
TTCTTTGCTCTCTTGTGAGTACCAAGCTTCCTCTTGGCGACCTTGAGTGCGCGCTTGTCCTTTCCAACCTTAAGAAGCTCAGTGATACGCTTCTCATAGG
GAGCAAATCCAGCGACCTCCCTAATCAAGTTCCTGACAAACAGCACCCTCTTGGTACCTTTCCCCTTGCGGTCGGACGGGCGAGGCGGCAGCTCGCGCTT
GGTGACGACGTGGCCCTTGTTGATGCCGACGAAGAGCCCTGACTTGGGCTGCAACGGCGCCATGGCCGGTCTCCTGCTAACCTTGAGAATGGATGCGAGT
TAAAACCCTAAGCCGCCTATGCATTTGTTCGAACGAACAGTGATGCGAAGCTATCATCCGTAGGATTAAGACTGAACGCCTCTAAGTCTGAATCCATGCT
GAACAAGAATAATTTAAAATTAAAATAACCCCGAAAAAGATGTTTCTTTAGGATAGAATTTTTTATTTTAAAAGATAAATTATTCCCGTATCATATGTAG
GGTAACGTTCAAAGATAACGACTAATTTTATCATGCGAGTTTTACCAAATAGCAATTTTTGTTTCAGGGGTTAGTCTCCGCGCGAACAGAGCCAGGCTGA
ACCTCAGCAAATCGTAAAGGACGTCCAGTTGCAGCAATGGCGGCAATCATGGTAGAGAGGTGGGCGGGGTTCGGGTCGGCTATGGCGACCGTCATCTTTC
TCTGGTCCGTGGTGCAGAACTACGTACCTCCCACCTTCCGCCTCTACCTCACCGCCTGGGCCGCAAAGGTCGCCGCCTGCTTCAACCCCTACCTCCAAAT
CACCATCTCCGAGTATGGCGCCGAGCGCTTCCAGCGTAGCGACTTCTTCCTCGCCGTTGAGGCCTACCTCAGCGAGGCATGCGCCCGGCGCGCACGGAAG
CTCAAGGCCGAGCTCGGCAAGGACAGCAAGAACCTCCAGGTCACCGTCGACGACCACGACGAGGTCACCGACGACTTCTCCGGCACGACCATCTGGTGGT
ACGCCTCCAAGCGGCAGTCCAAGGCCCAAGTCATCAGCTTCTACCCCGGCGAGGACGAGCGGCGCTTCTACAAGGTCATCTTCCACAGGCGCCACCGCGA
CCTTGTCGTCGACTCCTACCTGCCCTTCGTGCTCGGCGAGGGTCGCGCCGTCACCGTCAAGAACCGCCAGCGCCGTCTCTTCACCAACAACGCCAGCCGC
AACTGGAACCCCTACCGCAGCAAGAGCGTCTGGAGCCACGTCCCCTTCGAGCACCCCGCCACCTTCGACACGCTCGCCATGCACCCCGATGAGAAGGAGG
CCATCGTTGACGACCTCATGGCATTCCAGGAGAGCAAGGACTACTATGCAAAGGTCGGCAAGGCGTGGAAGCGCGGGTACCTCCTTTATGGACCGCCCGG
CACCGGCAAGTCCACCATGATCGCCGCCATGGCCAACTTCCTTGACTACG
page-top