Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1035  (registered. 2007)
Contig Information
Length 709 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 1300013D05Rik protein [Brugia malayi] >gi|158603141|gb|EDP39187.1| 1300013D05Rik protein, putative [Brugia malayi]
Score 77
Evalue 9.1665
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1035
CACTAAAGTTGAAGAGGGAAAAAAGCCAAGAGAAGAAGAACAAAATGGACAGTGGCGGTTCATCCGGTGGAAACAATCAAGGCAAGAAAAAGAGCAAGAA
ACGTGTGCTGACCGCTGAAGAGCTGGAAAACCGGCGGCTTGAGAACGTGCAACCTACCTCTTGGGACGATGAGTGGATTGTAACACTGAACATCACAGAT
AACGTGGTGGAGGATGAAGACACTAGTAGCATGGTGAGCACTTTCTCGACAGACAGCCCCTTCTCGATAGACCCCGAGGAGGAGACTGACAAGGAGGAGG
CTGACAATGAAGAGGAGGAGGAGGAGGGGGATGAAGAGGAGGCTGACAATGAGGATGAGGAGGAGGAGGATGAAGAGGGGCTGACAATGAGGATGAGGAG
TAGGAGGAGGAGGCTGACGGAAACGGTGACGGTGACAAGAAAAAGGAGGATCAGACTGACGACGATGATGGCGATCAGACTGACAATGGCAATGGCGAGG
ACCTCAGCTAACTCCAAGTTGTGCTTAAGACATGGTAGATGATTTGCTGGTAATAAGAAGTCTTATGCATCTTCTGGGCAGCTATAGACTAAGTCTGTTA
TGTTTGTACTTGAACCCTGCATGCACGTACGCATGCCAATTTATGTATGTCCTGTGTACCACTATGTTTCTGTCTAAANTATGCTANTGAAACATTGTAA
TTTGNGGAA
page-top