Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig1024  (registered. 2007)
Contig Information
Length 461 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acyl-CoA-binding domain-containing protein 6 [Zea mays]
Score 225
Evalue 2.4061e-17
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig1024
GCAGACCGCGCTCCACTACGCCGTCCTCTGCGAGAGGGAGGACATCGCCGAACTGCTCGTCAAGCACCACGCCGATCTCCAGATCAAGGACGGCGATGGG
AACACCGCCCAGGACTTGTGCTCCTCGGCCTGGCCTTTCATGAAGCCGGCAAACTGATGGCACAATGAACCCGATGATACGTTGACGCCTCCTGCTACTA
CTACTAGTGCCGAGAAACTATACACACCGTGCTTGATTAGCTGAATCGGATGAGCCGTTTTACCAACCTCATCGAATACACTGTCAAAAGGTAACTCAGC
GCAGGGTAGACATCTTGTAGTAGTGTTTTGCCTGTTTCATACGGTTTTTAGTGTGTTTGTGCTGCAGGCCAACTGTTTGGCAGGAAACATATCAGTGTCA
GGATTCAGGTCTCGTGGCCTCATACTGTCAATATGCATACATCTTAAGAGCAAAAAAAAAA
page-top