Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9608  (registered. 2012)
Contig Information
Length 733 bp
Clones alternative view 77 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 6
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|94984080|gb|ABF50675.1|| vacuolar ATPase subunit G [Triticum aestivum]
Score 208
Evalue 5.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9608
TTTTTTTTTTGATTAAAAACTTATTTACTCTTATGAATAATATATTTCACATAAAAAAATACATATACTGATAGCCATACAAGGGAGAGACAAAAGGGAC
GGAAATCGACAAAATTTACGAACTAATCACCAAAGGTTTAGCAAGTAGTATCAGACATGGCTGCTGCTGAACTGTAGCAGCTTATTTCCAAGACAACAAG
GAATTACAGCTGGAAGTGGCAAAAGCCATTTCTTATAATACCTCCCAAAGAAATGAACAGATAGTACAAAGTTGCCATCATATGCAGGGCTGACTCATCA
ACCTTTAGTTCTTCACAGTTGTGACGTGCCTCAGAAGCATCTGAATCACCTCTGGAGAGATGTTTGCTGCCTGCTGCTTGAGCTGCTCAATCTTTACGTT
TGTCTCTTGCTCAAGGCGTTTGACGTTTGCGCCAGAGTCACCGCTGGTCTCAGTGAGCTTCCTCTGGAAATCAGCCTCCATTTGTGCACGGTACTCAGCT
ATTTCTCTCTCAGCCTCTTCTTTGGCTTGCCTAAGCCTTGCCGTTTTAGCAGCCCTAGCAGCATTTACAATTTGCTGAGCCTCTTGCTCTGCAGCAAGCA
ATTGCTGGATTCCACTCGGGCGCCTGCTAGAGTCCATGTTTGGGCTGACGGGGGAGAGGCGAGGCGACTCGAATCACGTGGAAGACGAGAAGGGTCCGTG
GGGAAAAGCTATCCTCTGCTGCTCCCCTCGTGC
page-top